Only this pageAll pages
Powered by GitBook
Couldn't generate the PDF for 132 pages, generation stopped at 100.
Extend with 50 more pages.
1 of 100

Illumina Connected Analytics

Loading...

Get Started

Loading...

Loading...

Home

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Project

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Command-Line Interface

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Sequencer Integration

Loading...

Tutorials

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

Loading...

About the Platform

Illumina® BioInsight Platform Core (previously known as Illumina Connected Analytics) is a cloud-based software platform intended to be used to manage, analyze, and interpret large volumes of multi-omics data in a secure, scalable, and flexible environment. The versatility of the system allows the platform to be used for a broad range of applications.

When using the applications provided on the platform for diagnostic purposes, it is the responsibility of the user to determine regulatory requirements and to validate for intended use, as appropriate.

The platform is hosted in regions listed below.

Region Name
Region Identifier

Australia

AU

Canada

CA

Germany

EU

India

IN

Indonesia

ID

Japan

JP

Singapore

SG

South Korea

KR

United Kingdom

GB

United Arab Emirates

AE

United States

US

The platform hosts a suite of RESTful HTTP-based application programming interfaces (APIs) to perform operations on data and analysis resources. A web application user-interface is hosted alongside the API to deliver an interactive visualization of the resources and enables additional functionality beyond automated analysis and data transfer. Storage and compute costs are presented via usage information in the account console, and a variety of compute resource options are specifiable for applications to fine tune efficiency.

Our systems are synchronized using a Cloud Time Sync Service to ensure accurate timekeeping and consistent log timestamps.

Getting Started

The user documentation provides material for learning the basics of interacting with the platform including examples and tutorials. Start with the Get Started documentation to learn more.

Getting Help

Use the search bar on the top right to navigate through the help docs and find specific topics of interest.

If you have any questions, contact Illumina Technical Support by phone or email:

Illumina Technical Support | techsupport@illumina.com | 1-800-809-4566

For customers outside the United States, Illumina regional Technical Support contact information can be found at www.illumina.com/company/contact-us.html.

To see the current Platform Core version you are logged in to, click your username found on the top right of the screen and then select About.

Other Illumina Products

To view a list of the products to which you have access, select the 9 dots symbol at the top right of Platform Core. This will list your products. If you have multiple regional applications for the same product, the region of each is shown between brackets.

The More Tools category presents the following options

  • My Illumina Dashboard to monitor instruments, streamline purchases and keep track of upcoming activities.

  • Link to the Support Center for additional information and help.

  • Link to the order management from where you can keep track of your current and past orders.

Release Notes

In the Release Notes section of the documentation, posts are made for new versions of deployments of the core platform components.

Get Started

Software Registration

If you are a new user, please consult the Illumina BioInsight Platform Registration Guide for detailed guidance on setting up an account and registering a subscription.

Tenant Setup

The platform requires a provisioned tenant in the Illumina account management (IAM) system with access to the Illumina BioInsight Platform Core application. Once a tenant has been provisioned, a tenant administrator will be assigned. The tenant administrator has permission to manage account access including adding users, creating workgroups, and adding additional tenant administrators.

Each tenant is assigned a domain name used to login to the platform. The domain name is used in the login URL to navigate to the appropriate login page in a web browser. The login URL is https://<domain_name>.login.illumina.com with <domain_name> replaced by the actual domain name.

For more details on identity and access management, please see the Illumina BioInsight Platform help.

If you have intrusion detection systems active on your infrastructure, be aware that activities performed by Platform Core on your behalf (such as accessing your own S3 storage ) might trigger suspicious activity alerts. Please review the alerts and rules with your vendor to set up appropriate policies on your detection system.

  • by the tenant administrator by logging in to their domain and navigating to Illumina Account Management under their profile at the top right

  • or by the user by accessing https://platform.login.illumina.com and selecting the option Don't have an account.

Once the account has been added to the domain, the tenant administrator may assign registered users to workgroups which bundle users with permission to use the Platform Core application. Registered users can be made workgroup administrators by tenant administrators or existing workgroup administrators.

API Keys

If you want to use the command-line interface (CLI) or the Application Programming Interface (API), you can use an API Key as credentials when logging in. API Keys operate similar to a user name and password combination and must be kept secure and rotated on a regular basis (preferably yearly). `

When keys are compromised or no longer in use, they must be revoked. This is done through the domain login URL by navigating to the User menu item on the left and selecting "API Keys", followed by selecting the key and using the trash icon next to it.

Generate an API Key

API Keys are limited to 10 per user and are managed through the product dashboard after logging in through the domain login URL. See Managing API Keys for more information.

For security reasons, do not use accounts with administrator level access to generate API keys. Create a specific CLI user with basic permissions instead. This will minimize the possible impact of compromised keys.

Once the API key generation window is closed, the key contents will not be accessible through the domain login page, so be sure to store it securely for future reference.


Access via Web UI

The web application provides a visual user interface (UI) for navigating resources in the platform, managing projects, and extended features beyond the API. To access the web application, navigate to the Illumina BioInsight Platform Core portal.

  • On the left, you have the navigation bar (1) which will auto-collapse on smaller screens. To collapse it, use the double arrow symbol (2). When collapsed, use the >> symbol to expand it.

  • The central part (3) of the display is the item on which you are performing your actions and the breadcrumb menu (4) to return to the projects overview or a previous level. You can also use your browser's back button to return to the level from which you came.

  • At the top right, you have icons to refresh contents (5) Illumina product access (6), access to the online help (7) and user information (8).

Access via the CLI

The command-line interface offers a developer-oriented experience for interacting with the APIs to manage resources and launch analysis workflows. Find instructions for using the command-line interface including download links for your operating system in the CLI documentation.

Access via the API

The HTTP-based application programming interfaces (APIs) are listed in the API Reference section of the documentation. The reference documentation provides the ability to call APIs from the browser page and shows detailed information about the API schemas. HTTP client tooling such as Postman or cURL can be used to make direct calls to the API outside of the browser.

When accessing the API using the API Reference page or through REST client tools, the Authorization header must be provided with the value set to Bearer <token> where <token> is replaced with a valid JSON Web Token (JWT). For generating a JWT, see JSON Web Token (JWT).


Object Identifiers

The object data models for resources that are created in the platform include a unique id field for identifying the resource. These fixed machine-readable IDs are used for accessing and modifying the resource through the API or CLI, even if the resource name changes.

JSON Web Token (JWT)

Accessing the platform APIs requires authorizing calls using JSON Web Tokens (JWT). A JWT is a standardized trusted claim containing authentication context. This is a primary security mechanism to protect against unauthorized cross-account data access.

A JWT is generated by providing user credentials (API Key or username/password) to the token creation endpoint. Token creation can be performed using the API directly or the CLI.

Event Log

The event log shows an overview of system events with options to search and filter. For every entry, it lists the following:

  • Event date and time

  • Category (error, warn or info)

  • Code

  • Description

  • Tenant

Up to 200,000 results will be be returned. If your desired records are outside the range of the returned records, please refine the filters or use the search function at the top right.

Export is restricted to the amount of entries shown per page. You can use the selector at the bottom to set this to up to 1000 entries per page.

Data Integrity

You can verify the integrity of the data by comparing the hash which is usually (with some exceptions) an MD5 (Message Digest Algorithm 5) checksum. This is a common cryptographic hash function that generates a fixed-size, 128-bit hash value from any input data. This hash value is unique to the content of the data, meaning even a slight change in the data will result in a significantly different MD5 checksum. AWS S3 calculates this checksum when data is uploaded and stores it in the ETag (Entity tag).

For files smaller than 16 MB, you can directly retrieve the MD5 checksum using our API endpoints. Make an API GET call to the https://ica.illumina.com/ica/rest/api/projects/{projectId}/data/{dataId} endpoint specifying the data Id you want to check and the corresponding project ID. The response you receive will be in JSON format, containing various file metadata. Within the JSON response, look for the objectETag field. This value is the MD5 checksum for the file you have queried. You can compare this checksum with the one you compute locally to ensure file integrity.

This ETag does not change and can be used as a file integrity check even when that file is archived, unarchived and/or copied to another location. Changes to the metadata have no impact on the ETag

For larger files, the process is different due to computation limitations. In these cases, we recommend using a dedicated pipeline on our platform to explicitly calculate the MD5 checksum. Below you can find both a main.nf file and the corresponding XML for a possible Nextflow pipeline to calculate the MD5 checksum for FASTQ files.

nextflow.enable.dsl = 2


process md5sum {
    
    container "public.ecr.aws/lts/ubuntu:22.04"
    pod annotation: 'scheduler.illumina.com/presetSize', value: 'standard-small'
    
    input:
        file txt

    output:
        stdout emit: result
        path '*', emit: output

    publishDir "out", mode: 'symlink'

    script:
        txt_file_name = txt.getName()
        id = txt_file_name.takeWhile { it != '.'}

        """
        set -ex
        echo "File: $txt_file_name"
        echo "Sample: $id"
        md5sum ${txt} > ${id}_md5.txt
        """
    }

workflow {
    txt_ch = Channel.fromPath(params.in)
    txt_ch.view()
    md5sum(txt_ch).result.view()
}

Storage Cost Managment

Since there is a storage cost associated with the data in your projects, it is good practice to regularly check how much cost is being generated by your projects and evaluate which data can be removed from cloud storage. The instructions provided here will help you quickly determine which data is generating the highest storage costs.

Monitoring Storage Cost

To see how much storage costs are currently being generated for your tenant, you can look at the usage explorer at https://platform.illumina.com/usage/ or from within Platform Core, navigate to the 9-dot symbol () in the top right next to your name and choose the usage explorer from the menu.

From the usage explorer overview screen, you can see below the graphical representation which projects are incurring the highest storage costs.

Project Files in Platform Core

When you have determined which projects are incurring the largest storage costs, you can find out which files within that project are taking up the most space. To find the largest files in your project,

  1. Go to Projects > your_project > Data and switch to list view with the () icon left above your files.

  2. Use the column icon () top right to add the size column to your view. You can drag the size column to the desired position in your list view or use the move left and use right options which appear when you select the three vertical dots.

  3. Select Sort descending to show the largest files first.

  1. Once you have the list sorted like this, you can evaluate if those large files are still needed, if the can be sent to archive (manage > archive) or if they can be deleted (manage > delete).

Data - Troubleshooting

Path too long

If you get an error "Unable to generate credentials from the objectstore as the requested path is too long." from AWS when requesting temporary credentials, then the path should be shortened.

You can truncate the sample name and user reference or use advanced output mapping in the API which avoids generating the long folders and creates output in the targetPath-defined location.

"analysisOutput": [
{
"sourcePath": "out",
"type": "FOLDER",
"targetProjectId": "enter_your_target_project_id",
"targetPath": "/enter_your_target_folder/"
}
]

Files remaining on own S3 Storage

Before copy and move operations are executed on your own S3 storage, a test is performed to verify the necessary operational rights. If an issue is encountered, the copy/move action is aborted and the test files can be left behind due to missing rights. These files can safely be manually deleted from your S3 console.

Samples

You can use samples to group information related to a sample, including input files, output files, and analyses. You can consider samples as creating a binder to collect related information. When you then link that sample to another project, you bring over the empty binder, but not the files contained in it. In that project, you can then add your own data to it.

You can search for samples (excluding their metadata) with the Search button at the top right.

Add New Sample

To add a new sample, do as follows.

  1. Select Projects > your_project > Samples.

  2. To add a new sample, select + Create, and then enter a unique name and description for the sample.

  3. To add files to the sample, see adding files to a sample

Your sample is added to the Samples page. To view information on the sample, select the sample name in the overview.

Add Files to Samples

You can add files to a sample after creating the sample. Any files that are not currently linked to a sample are listed on the Unlinked Files tab.

To add an unlinked file to a sample, do as follows.

  1. Go to Projects > your_project > Samples > Unlinked files tab.

  2. Select a file or files, and then select one of the following options:

    • Create sample — Create a new sample that includes the selected files.

    • Link to sample — Select an existing sample in the project to which you link the file.

Alternatively, you can add unlinked files from the sample details.

  1. Going to Projects > your_project > Samples > your_sample.

  2. Select your sample to open the details.

  3. Go to the Data tab and select link.

  4. If the data is not in your project, you will need to add it in Projects > your_project > Data

Data can only be linked to a single sample, so once you have linked data to a sample, it will no longer appear in the list of data to choose form.

Unlink Files from Samples

To remove files from samples,

  1. Go to Projects > your_project > Samples > your_sample > Data

  2. Select the files you want to remove.

  3. Select Unlink.

If your selection contains both unlinkable samples and non-unlinkable samples (for example linked via a linked bundle), then this will be indicated in the confirmation dialog and only the unlinkable samples will be unlinked.

Link Samples to Project

A Sample can be linked to a project from a separate project to make it available in read-only capacity.

  1. Navigate to the Samples view in the Project

  2. Click the Link button

  3. Select the Sample(s) to link to the project

  4. Click the Link button

Data linked to Samples is not automatically linked to the project. The data must be linked separately from the Data view. Samples also must be available in a complete state in order to be linked.

Delete Samples

If you want to remove a sample, select it and use the delete option from the top navigation row. You will be presented a choice of how to handle the data in the sample.

  • Unlink all data without deleting it.

  • Delete input data and unlink other data.

  • Delete all data.

Flow

Flow provides tooling for building and running secondary analysis pipelines. The platform supports analysis workflows constructed using Common Workflow Language (CWL) and Nextflow. Each step of an analysis pipeline executes a containerized application using inputs passed into the pipeline or output from previous steps.

You can configure the following components in Illumina Connected Analytics Flow:

  • Reference Data — Reference Data for Graphical CWL flows. See Reference Data.

  • Pipelines — One or more tools configured to process input data and generate output files. See Pipelines.

  • Analyses — Launched instance of a pipeline with selected input data. See Analyses.

JSON-Based input forms

Introduction

Pipelines defined using the "Code" mode require an XML or JSON-based input form to define the fields shown on the launch view in the user interface (UI).

To create a JSON-based Nextflow (or CWL) pipeline, go to Projects > your_project > Flow > Pipelines > +Create > Nextflow (or CWL) > JSON-based.

The files listed here, located on the inputform files tab, work together for evaluating and presenting JSON-based input.

  • inputForm.json contains the actual input form which is rendered when starting the pipeline run.

  • onRender.js is triggered when a value is changed.

  • onSubmit.js is triggered when starting a pipeline via the GUI or API.

  • onFinish.js (optional, not automatically created) is triggered once the pipeline analysis has been completed

Use + Create to add additional files and Simulate to test your inputForms.

Scripting execution supports crossfield validation of the values, hiding fields, making them required, .... based on value changes.

Sun Grid Engine (SGE) on Platform Core Bench

Running Jobs in a Bench SGE Cluster

Once a cluster is started, the cluster manager can be accessed from the workspace node.

Job resources

Every cluster member has a certain capacity which is determined by the selected Resource model for the cluster member.

The following complex values have been added to the SGE cluster environment and are requestable.

  • static_cores (default: 1)

  • static_mem (default: 2G)

These values are used to avoid oversubscription of a node which can result in Out-Of-Memory or unresponsiveness. You need to ensure these limits are not exceeded.

To ensure stability of the system, some headroom is deducted from the total node capacity.

Scaling

These two values are used by the SGE auto scaler when running in dynamic mode. The SGE auto scaler will summarise all pending jobs and their requested resources to determine the scale up/down operation within the defined range.

Cluster members will remain in the cluster for at least 300 seconds. The Auto scaler only executes one scale up/down operation at a time and is stabilised before taking on a new operation.

Job requests that require more resources than the capacity of the selected resource model will be ignored by the auto scaler and will wait indefinitely.

The operation of the auto scaler can be monitored in the log file /data/logs/sge-scaler.log

Submitting jobs

Submitting a single job

Submitting a job array

Do not limit the job concurrency amount as this will result in unused cluster members.

Monitoring members

Listing all members of the cluster

Managing running/pending jobs

listing all jobs in the cluster

Showing the details of a job.

Deleting a job.

Managing executed jobs

Showing the details of an executed job.

SGE Reference documentation

SGE command line options and configuration details can be found here.

JupyterLab

Bench workspaces require setting a Docker image to use as the image for the workspace. Platform Core provides a default Docker image with JupyterLab installed.

JupyterLab supports Jupyter Notebook documents (.ipynb). Notebook documents consist of a sequence of cells which may contain executable code, markdown, headers, and raw text.

The JupyterLab Docker image contains the following environment variables:

Variable
Set to

ICA_URL

https://ica.illumina.com/ica (Platform Core server URL)

ICA_PROJECT_UUID

Current project UUID

ICA_SNOWFLAKE_ACCOUNT

Platform Core Snowflake (Base) Account ID

ICA_SNOWFLAKE_DATABASE

Platform Core Snowflake (Base) Database ID

ICA_PROJECT_TENANT_NAME

Name of the owning tenant of the project where the workspace is created.

ICA_STARTING_USER_TENANT_NAME

Name of the tenant of the user which last started the workspace.

ICA_COHORTS_URL

URL of the Cohorts web application used to support the Cohort's view

To export data from your workspace to your local machine, it is best practice to move the data in your workspace to the /data/project/ folder so that it becomes available in your project under projects > your_project > Data.

Platform Core Python Library

Included in the default JupyterLab Docker image is a python library with APIs to perform actions in Platform Core, such as add data, launch pipelines, and operate on Base tables. The python library is generated from the Open API specification using openapi-generator.

The Platform Core Python library API documentation can be found in folder /etc/ica/data/ica_v2_api_docs within the JupyterLab Docker image.

See the Bench ICA Python Library Tutorial for examples on using the Platform Core Python library.

FUSE Driver

Bench Workspaces use a FUSE driver to mount project data directly into a workspace file system. There are both read and write capabilities with some limitations on write capabilities that are enforced by the underlying AWS S3 storage.

As a user, you are allowed to do the following actions from Bench (when having the correct user permissions compared to the workspace permissions) or through the CLI:

  • Copy project data

  • Delete project data

  • Mount project data (CLI only)

  • Unmount project data (CLI only)

When you have a running workspace, you will find a file system in Bench under the project folder along with the basic and advanced tutorials. When opening that folder, you will see all the data that resides in your project.

This is a fully mounted version of the project data. Changes in the workspace to project data cannot be undone.

Copy project data

The FUSE driver allows the user to easily copy data from /data/project to the local workspace and vice versa. There is a file size limit of 500 GB per file for the FUSE driver.

Delete project data

The FUSE driver also allows you to delete data from your project. This is different from the use of Bench before where you took a local copy and still kept the original file in your project.

Deleting project data through Bench workspace through the FUSE driver will permanently delete the data in the Project. This action cannot be undone.

CLI

Using the FUSE driver through the CLI is not supported for Windows users. Linux users will be able to use the CLI without any further actions, Mac users will need to install the kernel extension from macFuse.

MacOS uses hidden metadata files beginning with ._ ,which are copied over and exposed during CLI copy to your project data. These can be safely deleted from your project.

Mount and unmount of data can be done in the CLI with the commands icav2 projectdata mount mnt--project-id <your_project_uuid> and icav2 projectdata unmount. In Bench this happens automatically and the CLI commands are not needed.

Do NOT use the CP -f command to copy or move data to a mounted location. This will result in data loss as data on the destination location will be deleted.

Restrictions

Once a file is written, it cannot be changed! You will not be able to update it in the project location because of the restrictions mentioned above.

Trying to update files or saving you notebook in the project folder will typically result in File Save Error for fusedrivererror.ipynb Invalid response: 500 Internal Server Error.

Some examples of other actions or commands that will not work because of the above mentioned limitations:

  • Save a jupyter notebook or R script on the /project location

  • Add/remove a file from an existing zip file

  • Redirect with append to an existing file e.g. echo "This will not work" >> myTextFile.txt

  • Rename a file due to the existing association between Platform Core and AWS

  • Move files or folders.

  • Using vi or another editor

A file can be written only sequentially. This is a restriction that comes from the library the FUSE driver uses to store data in AWS. That library supports only sequential writing, random writes are currently not supported. The FUSE driver will detect random writes and the write will fail with an IO error return code. Zip will not work since zip writes a table of contents at the end of the file. Please use gzip.

Listing data (ls -l) reads data from the platform. The actual data comes from AWS and there can be a short delay between the writing of the data and the listing being up to date. As a result, a file that is written may appear temporarily as a zero length file, a file that is deleted may appear in the file list. This is a tradeoff, the FUSE driver caches some information for a limited time and during that time the information may seem wrong. Note that besides the FUSE driver, the library used by the FUSE driver to implement the raw FUSE protocol and the OS kernel itself may also do caching.

Jupyter notebooks

To use a specific file in a jupyter notebook, you will need to use '/data/project/filename'.

Old Bench workspaces

This functionality won't work for old workspaces unless you enable the permissions for that old workspace.

Prepare Metadata Sheets

In Platform Core Cohorts, metadata describe any subjects and samples imported into the system in terms of attributes, including:

  • subject:

    • demographics such as age, sex, ancestry;

    • phenotypes and diseases;

    • biometrics such as body height, body mass index, etc.;

    • pathological classification, tumor stages, etc.;

    • family and patient medical history;

  • sample:

    • sample type such as FFPE,

    • tissue type,

    • sequencing technology: whole genome DNA-sequencing, RNAseq, single-cell RNAseq, among others.

You can use these attributes while creating a cohort to define the cases and/or controls that you want to include.

During import, you will be asked to upload a metadata sheet as a tab-delimited (TSV) file. An example sheet is available for download on the Import files page in the Platform Core Cohorts UI.

A metadata sheet will need to contain at least these four columns per row:

  • Subject ID - identifier referring to individuals; use the column header "SubjectID".

  • Sample ID - identifier for a sample. Sample IDs need to match the corresponding column header in VCF/GVCFs; each subject can have multiple samples, these need to be specified in individual rows for the same SubjectID; use the column header "SampleID".

  • Biological sex - can be "Female (XX)", "Female"; "Male (XY)", "Male"; "X (Turner's)"; "XXY (Klinefelter)"; "XYY"; "XXXY" or "Not provided". Use the column header "DM_Sex" (demographics).

  • Sequencing technology - can be "Whole genome sequencing", "Whole exome sequencing", "Targeted sequencing panels", or "RNA-seq"; use the column header "TC" (technology).

A description of all attributes and data types currently supported by Platform Core Cohorts can be found here: ICA_Cohorts_Supported_Attributes.xlsx

You can download an example of a metadata sheet, which contains some samples from The Cancer Genome Atlas (TCGA) and their publicly available clincal attributes, here: ICA_Cohorts_Example_Metadata.tsv

A list of concepts and diagnoses that cover all public data subjects to easily navigate the new concept code browser for diagnosis can be found here: PublicData_AllConditionsSummarized.xlsx

Precomputed GWAS and PheWAS

The GWAS and PheWAS tabs in Platform Core Cohorts allow you to visualize precomputed analysis results for phenotypes/diseases and genes, respectively.

These do not reflect the subjects that are part of the cohort that you created.

Platform Core Cohorts currently hosts GWAS and PheWAS analysis results for approximately 150 quantitative phenotypes, such as "LDL direct" and "sitting height", and about 700 diseases.

Visualize Results from Precomputed Genome-Wide Association Studies (GWAS)

Navigate to the GWAS tab and start looking for phenotypes and diseases in the search box. Cohorts will suggest the best matches against any partial input, such as "cancer", you provide. After selecting a phenotype or disease, Cohorts will render a Manhattan plot, by default collapsed to gene level and organized by their respective position in each chromosome.

Circles in the Manhattan plot indicate binary traits, potential associations between genes and diseases. Triangles indicate quantitative phenotypes with regression Beta different from zero, and point up or down to depict positive or negative correlation, respectively.

Hovering over a circle/triangle will display the following information:

  • gene symbol

  • variant group (see below)

  • P-value, both raw and FDR-corrected

  • number of carriers of variants of the given type

  • number of carriers of variants of any type

  • regression Beta

For gene-level results, Cohorts distinguishes five different classes of variants: protein truncating; deleterious; missense; missense with a high ILMN PrimateAI score, indicating likely damaging variants; and synonymous variants. You can limit results to either of these five classes, or select All to display all results together.

  • Deleterious variants (del): the union of all protein-truncating variants (PTVs, defined below), pathogenic missense variants with a PrimateAI score greater than a gene-specific threshold, and variants with a SpliceAI score greater than 0.2.

  • Protein-truncating variants (ptv): variant consequences matching any of stop_gained, stop_lost, frameshift_variant, splice_donor_variant, splice_acceptor_variant, start_lost, transcript_ablation, transcript_truncation, exon_loss_variant, gene_fusion, or bidirectional_gene_fusion.

  • missense_all: all missense variants regardless of their pathogenicity.

  • missense, PrimateAI optimized (missense_pAI_optimized): only pathogenic missense variants with primateAI score greater than a gene-specific threshold.

  • missenses and PTVs (missenses_and_ptvs_all): the union of all PTVs, SpliceAI > 0.2 variants and all missense variants regardless of their pathogenicity scores.

  • all synonymous variants (syn).

To zoom in to a particular chromosome, click the chromosome name underneath the plot, or select the chromosome from the drop down box, which defaults to Whole genome.

Visualize Results from Precomputed Phenome-Wide Association Studies (PheWAS)

To browse PheWAS analysis results by gene, navigate to the PheWAS tab and enter a gene of interest into the search box. The resulting Manhattan plot will show phenotypes and diseases organized into a number of categories, such as "Diseases of the nervous system" and "Neoplasms". Click on the name of a category, shown underneath the plot, to display only those phenotypes or diseases, or select a category from the drop down, which defaults to All.

Connectivity

The platform provides Connectors to facilitate automation for operations on data (ie, upload, download, linking).

  • Service connectors sync data between your local computer or server and the project's cloud-based data storage.

  • Project connectors link data between individual projects.

Installation

Download links for the CLI can be found at the Release History.

Both the CLI and the service connector require x86 architecture. For ARM-based architecture on Mac or Windows, you need to keep x86 emulation enabled. Linux does not support x86 emulation.

After the file is downloaded, place the CLI in a folder that is included in your $PATH environment variable list of paths, typically /usr/local/bin. Open the Terminal application, navigate to the folder where the downloaded CLI file is located (usually your Downloads folder), and run the following command to copy the CLI file to the appropriate folder. If you do not have write access to your /usr/local/bin folder, then you may use sudo (which requires a password) prior to the cp command. For example:

After the file is downloaded, place the CLI in a folder that is included in your $PATH environment variable list of paths, typically /usr/local/bin. Open the Terminal application, navigate to the folder where the downloaded CLI file is located (usually your Downloads folder), and run the following command to copy the CLI file to the appropriate folder. If you do not have write access to your /usr/local/bin folder, then you may use sudo (which requires a password) prior to the cp command. For example:

sudo cp icav2 /usr/local/bin

If you do not have sudo access on your system, contact your administrator for installation. Alternately, you may place the file in an alternate location and update your $PATH to include this location (see the documentation for your shell to determine how to update this environment variable).

You will also need to make the file executable so that the CLI can run:

sudo chmod a+x /usr/local/bin/icav2

You will likely want to place the CLI in a folder that is included in your $PATH environment variable list of paths. In Windows, you typically want to save your applications in the C:\Program Files folder. If you do not have write access to that folder, then open a CMD window in administrative mode (hold down the SHIFT key as you right-click on the CMD application and select "Run as administrator"). Type in the following commands (assuming you have saved ica.exe in your current folder):

 mkdir "C:\Program Files\Illumina"
 copy icav2.exe "C:\Program Files\Illumina"

Then you make sure that the C:\Program Files\Illumina folder is included in your %path% list of paths. Please do a web search for how to add a path to your %path% system environment variable for your particular version of Windows.

Authentication

The Platform Core CLI uses an Illumina API Key to authenticate. An Illumina API Key can be acquired through the product dashboard after logging into a domain. See API Keys for instructions to create an Illumina API Key.

Authenticate using icav2 config set command. The CLI will prompt for an x-api-key value. Input the API Key generated from the product dashboard here. See the example below (replace EXAMPLE_API_KEY with the actual API Key).

icav2 config set
Creating /Users/johngenome/.icav2/config.yaml
Initialize configuration settings [default]
server-url [ica.illumina.com]: 
x-api-key : EXAMPLE_API_KEY
output-format (allowed values table,yaml,json defaults to table) : 
colormode (allowed values none,dark,light defaults to none) :

The CLI will save the API Key to the config file as an encrypted value.

If you want to overwrite existing environment values, use the command icav2 config set. To remove an existing configuration/session file, use the command icav2 config reset.\

Check the server and confirm you are authenticated using icav2 config get

icav2 config get
access-token: ""
colormode: none
output-format: table
server-url: ica.illumina.com
x-api-key: !!binary HASHED_EXAMPLE_API_KEY

If during these steps or in the future you need to reset the authentication, you can do so using the command: icav2 config reset

Data Transfer

The Platform Core CLI can be used for uploading, downloading and viewing information about data stored within Platform Core projects. If not already authenticated, please see the Authentication section. Once the CLI has been authenticated with your account, use the command below to list all projects:

icav2 projects list

The first column of the output (in default table format) will show the ID. This is the project-id and will be used in the examples below.

Upload Data

In this example, we will upload a file called Sample-1_S1_L001_R1_001.fastq.gz to the project. Copy your project-id obtained above and use the following command:

icav2 projectdata upload Sample-1_S1_L001_R1_001.fastq.gz --project-id <project-id>

To check if the file has uploaded, run the following command to get a list of all files stored within the specified project:

icav2 projectdata list --project-id <project-id>

This will show a file ID starting with fil. which can be used to get more information about the file and attributes.

icav2 projectdata get <file-id> --project-id <project-id>

We have to use --project-id in the examples above because we have not entered into a specific project context. To enter a project context use the following command.

icav2 projects enter <project-name or project-id>

This will infer the project-id, so that it does not need to be entered for each command.

Uploading Multiple Files

You can only upload individual files with the projectdata upload command. Wildcards are not supported.

If you want to upload multiple files in a folder, based on a common name, you can use the following method from the folder where the files are located ls VAL-0* | xargs -I {} icav2 projectdata upload "{}" /my_upload/my_files/ --project-id <project-id>

  • ls VAL-0* lists all files in the current directory whose names start with VAL-O, for example VAL-001.txt, VAL-002.bin,...

  • | The pipe symbol takes the output of the ls command and passes is as input to the next command

  • xargs -I {} take the list of files and execute the next command while replacing the curly brackets for every individual file.

  • icav2 projectdata upload "{}" /my_upload/my_files/ This command gets executed for each file and uploads that file to the /my_upload/my_files/ folder

  • --project-id <project-id> The id of the project in which you want to upload the files (only needed if you have not entered a project context)

Filenames beginning with / are not allowed, so be careful when entering full path names as those will result in the file being stored on S3 but not being visible in Platform Core. Likewise, folders containing a / in their individual folder name and folders named '.' are not supported

Download Data

The Platform Core CLI can also be used to download files. This can be useful if the download destination is a remote server or HPC cluster into which you are logged in. To download data into the current folder, run the following command:

icav2 projectdata download <file-id> ./ --project-id <project-id>

Temporary Credentials

If the path is provided, the project id from the flag --project-id is used. If the --project-id flag is not present, then the project id is taken from the context.

The returned AWS credentials for file or folder upload expire after 12 hours for role-based credentials, 36 hours for all other credentials.

Data Transfer Options

For information on options such as using the Platform Core API and AWS CLI to transfer data, visit the Data Transfer Options tutorial.

Config Settings

The Platform Core CLI accepts configuration settings from multiple places, such as environment variables, configuration file, or passed in as command line arguments. When configuration settings are retrieved, the following precedence is used to determine which setting to apply:

  1. Command line options - Passed in with the command such as --access-token

  2. Environment variables - Stored in system environment variables such as ICAV2_ACCESS_TOKEN

  3. Default config file - Stored by default in the ~/.icav2/config.yaml on macOS/Linux and C:\Users\USERNAME\.icav2\.config on Windows

Command Line Options

The following global flags are available in the CLI interface:

Environment Variables

Environment variables provide another way to specify configuration settings. Variable names align with the command line options with the following modifications:

  • Upper cased

  • Prefix ICAV2_

  • All dashes replaced by underscore

For example, the corresponding environment variable name for the --access-token flag is ICAV2_ACCESS_TOKEN.

Disable Retry Mechanism

The environment variable ICAV2_ICA_NO_RETRY_RATE_LIMITING allows to disable the retry mechanism. When it is set to 1, no retries are performed. For any other value, http code 429 will result in 4 retry attempts:

  • after 500 milliseconds

  • after 2 seconds

  • after 10 seconds

  • after 30 seconds

Config File

Upon launching icav2 for the first time, the configuration yaml file is created and the default config settings are set. Enter an alternative server URL or press enter to leave it as the default. Then enter your API Key and press enter.

After installing the CLI, open a terminal window and enter the icav2 command. This will initialize a default configuration file in the home folder at .icav2/config.yaml.

To reset the configuration, use ./icav2 config reset

Resetting the configuration removes the configuration from the host device and cannot be undone. The configuration needs to be recreated.

Configuration settings are stored in the default configuration file:

The file ~/.icav2/.session.ica.yamlon macOS/Linux and C:\Users\USERNAME\.icav2\.session.ica on Windows will contain the access-token and project-id. These are output files and should not be edited as they are automatically updated.

Examples

ICAV2_X_API_KEY

This variable is used to set the API Key.

  1. Command line options - Passed as --x-api-key <your_api_key> or -k <your_api_key>

  2. Environment variables - Stored in system as ICAV2_X_API_KEY

  3. Default config file - Use icav2 config set to update ~/.icav2/config.yaml(macOS/Linux) or C:\Users\USERNAME\.icav2\.config (Windows)

Output Format

The CLI supports outputs in table, JSON, and YAML formats. The format is set using the output-format configuration setting through a command line option, environment variable, or configuration file.

Dates are output as UTC times when using JSON/YAML output format and local times when using table format.

To set the output format, use the following setting:

--output-format <string>

  • json - Outputs in JSON format

  • yaml - Outputs in YAML format

  • table - Outputs in tabular format

Cloud Analysis Auto-launch

Please see the Illumina BioInsight Platform site for all content related to Cloud Analysis Auto-Launch:

  • Cloud Analysis Auto-Launch Guidance

  • Sequencer Auto-launch Analyses Compatibility

  • Sample Sheet v2 Guidance

  • NovaSeqX: BCL Convert Auto-launch Analysis in Cloud Guided Example

  • NovaSeq 6000: BCL Convert Auto-launch Analysis in Cloud Guided Example

<?xml version="1.0" encoding="UTF-8" standalone="yes"?>
<pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition">
    <pd:dataInputs>
        <pd:dataInput code="in" format="FASTQ" type="FILE" required="true" multiValue="true">
            <pd:label>Input</pd:label>
            <pd:description>FASTQ files input</pd:description>
        </pd:dataInput>
    </pd:dataInputs>
    <pd:steps/>
</pd:pipeline>
qsub -l static_mem=1G -l static_cores=1 /data/myscript.sh
qsub -l static_mem=1G -l static_cores=1 -t 1-100 /data/myscript.sh
qhost
qstat -f
qstat -f -j <jobId>
qdel <jobId>
qacct -j <jobId>
-t, --access-token string    JWT used to call rest service
-h, --help                   help for icav2
-o, --output-format string   output format (default "table")
-s, --server-url string      server url to direct commands
-k, --x-api-key string       api key used to call rest service
access-token: ""
colormode: none
output-format: table
server-url: ica.illumina.com
x-api-key: !!binary SMWV6dEXAMPLE

Introduction

Illumina® BioInsight Platform Core (previously known as Illumina Connected Analytics) is a cloud-based software platform intended to be used to manage, analyze, and interpret large volumes of multi-omics data in a secure, scalable, and flexible environment. The versatility of the system allows the platform to be used for a broad range of applications.

Get Started gives an overview of how to access and configure Platform Core with Network settings showing the access prerequisites.

New

To see what is new in the latest version, use the software release notes and the document revision history.

Home

The home section provides an overview of the main Platform Core sections such as projects (the main work location), bundles (asset packages), logging, metadata (to capture additional information), Docker and tool images (containerised applications) and how to configure (your own) storage.

Project

Projects are your primary work locations which contain your data and samples. Here you will create pipelines and use them for analyses. You configure who can access your project by means of the teams settings. The results can be processed with the help of Base, Bench or Cohorts. Projects can be considered as a binder for your work and information.

Command-Line Interface

This section contains information on how to download, install, authenticate, configure and use the command line interface, as alternative for the Platform Core GUI.

Sequencer Integration

Information and tutorials on cloud analysis auto launch.

Tutorials

There is a set of step-by-step Tutorials

  • Nextflow

  • CWL CLI

  • Base

  • Bench

  • API

  • Data Transfer

  • Pipeline Chaining

  • DRAGEN Analysis

Reference

In the Reference section, you can find more information on the API, Pricing, Security and Compliance,

For an overview of the available subscription tiers and functionality, please refer to this page on the Illumina website.

Projects

When looking at the main Platform Core navigation, you will see the following structure:

  • Projects are your primary work locations which contain your data and tools to execute your analyses. Projects can be considered as a binder for your work and information. You can have data contained within a project, or you can choose to make it shareable between projects.

  • Reference Data are reference genome sets which you use to help look for deviations and to compare your data against.

Bundles

Bundles are curated data sets which combine assets such as pipelines, tools, and Base query templates. This is where you will find packaged assets such as Illumina-provided pipelines and sample data. You can create, share and use bundles in projects of your own tenant as well as projects in other tenants.

There is a combined limit of 30 000 projects and bundles per tenant.

The following Platform Core assets can be included in bundles:

  • Data (link / unlink)

  • Samples (link / unlink)

  • (add / delete)

  • (link/unlink)

  • and (link/unlink)

  • (read-only) (link/unlink)

The main Bundles screen has two tabs: My Bundles and Entitled Bundles. The My Bundles tab shows all the bundles that you are a member of. This tab is where most of your interactions with bundles occur. The Entitled Bundles tab shows the bundles that have been specially created by Illumina or other organizations and shared with you to use in your projects. See .

  1. From the main navigation page, select Projects > your_project > Project Settings > Details.

  2. Click the Edit button at the top of the Details page.

  3. Click the + button, under Linked bundles.

The assets included in the bundle will now be available in the respective pages within the Project (e.g. Data and Pipelines pages). Any updates to the assets will be automatically available in the destination project.

To unlink a bundle from a project,

  1. Select Projects > your_project > Project Settings > Details.

  2. Click the Edit button at the top of the Details page.

  3. Click the (-) button, next to the linked bundle you wish to remove.

To create a new bundle and configure its settings, do as follows.

  1. From the main navigation, select Bundles.

  2. Select + Create.

  3. Enter a unique name for the bundle.

To make changes to a bundle:

  1. From the main navigation, select Bundles.

  2. Select a bundle.

  3. Select Edit.

  4. Modify the bundle information and documentation as needed.

To add assets to a bundle:

  1. Select a bundle.

  2. On the left-hand side, select the type of asset (such as Flow > pipelines, Base > Tables or Bench > Docker Images) you want to add to the bundle.

  3. Select link to add assets to the bundle.

Assets must meet the following requirements before they can be added to a bundle:

  • For samples and data, the the asset belongs to must have data sharing enabled.

  • The region of the project containing the asset must match the region of the bundle.

  • You must have permission to access the project containing the asset.

When you link folders to a bundle, a warning is displayed indicating that, depending on the size of the folder, linking may take considerable time. The linking process will run in the background and the progress can be monitored on the Bundles > your_bundle > activity > Batch Jobs screen. To see more details and the progress, double-click the batch job and then double-click the individual item. This will show how many individual files are already linked.

Which batch jobs are visible as activity depends on the user role.

When creating a new bundle version, you can only add assets to the bundle. You cannot remove existing assets from a bundle when creating a new version. If you need to remove assets from a bundle, it is recommended that you create a new bundle. All users wich currently have access to a bundle will automatically have access to the new version as well.

  1. From the main navigation, select Bundles.

  2. Select a bundle.

  3. Select the + Create new Version button.

  4. Make updates as needed and

When you create a new version of a bundle, it will replace the old version in your list. To see the old version, open your new bundle and look at Bundles > your_bundle > Details > Versioning. There you can open the previous version which is contained in your new version.

Assets such as data which were added in a previous version of your bundle will be marked in green, while new content will be black.

  1. From the main navigation, Select Bundles > your_bundle > Bundle Settings > Legal from the left hand navigation.

  2. To add Terms of Use to a Bundle, do as follows:

    • Select + Create New Version.

If you want to collaborate with other people on creating a bundle and managing the assets in the bundle, you can add users to your bundle and set their permissions. You use this to create a bundle together, not to use the bundle in your projects.

  1. From the main navigation, select Bundles > your_bundle > Bundle Settings > Team.

  2. To invite a user to collaborate on the bundle, do as follows.

    • To add a user from your tenant, select Someone of your tenant and select a user from the drop-down list.

Once you have finalized your bundle and added all assets and legal requirements, you can share your bundle with other tenants to use it in their projects.

Your bundle must be in released status to prevent it from being updated while it is shared.

  1. Go to Bundles > your_bundle > Edit > Details > Bundle status and set it to Released.

  2. Save the change.

Once the bundle is released, you can share it. Invitations are sent to an individual email address, however access is granted and extended to all users and all workgroups inside that tenant.

  1. Go to Bundles > your_bundle > Bundle Settings > Share.

  2. Click Invite and enter the email address of the person you want to share the bundle with. They will receive an email from which they can accept or reject the invitation to use the bundle. The invitation will show the bundle name, description and owner. The link in the invite can only be used once.

You can follow up on the status of the invitation on the Bundles > your_bundle > Bundle Settings > Share page.

  • If they reject the bundle, the rejection date will be shown. To re-invite that person again later on, select their email address in the list and choose Remove. You can then create a new invitation. If you do not remove the old entry before sending a new invitation, they will be unable to accept and get an error message stating that the user and bundle combination must be unique. They can also not re-use an invitation once it has been accepted or declined.

  • If they accept the bundle, the acceptance date will be shown. They will in turn see the bundle under Bundles > Entitled bundles. To remove access, select their email address in the list and choose Remove.

Entitled bundles are bundles created by Illumina or third parties for you to use in your projects. Entitled bundles can already be part of your tenant when it is part of your subscription. You can see your entitled bundles at Bundles > Entitled Bundles.

To use your shared entitled bundle, add the bundle to your project via Project Linking.

  1. From the main navigation page, select Projects > your_project > Project Settings > Details.

  2. Click the Edit button at the top of the Details page.

  3. Click the + button, under Linked bundles.

Content shared via entitled bundles is read-only, so you cannot add or modify the contents of an entitled bundle. If you lose access to an entitled bundle previously shared with you, the bundle is unlinked and you will no longer be able to access its contents.

Docker Repository

In order to create a Tool or Bench image, a Docker image is required to run the application in a containerized environment. Illumina BioInsight Platform Core supports both public Docker images and private Docker images uploaded to Platform Core.

Use Docker images built for x86 architecture or multi-platform images that support x86. You can build Docker images that support both ARM and X86 structure.

Importing a Public External Image (Tools)

  1. Navigate to System Settings > Docker Repository.

  2. Click Create > External image to add a new external image.

  3. Add your full image URL in the Url field, e.g. docker.io/alpine:latest or registry.hub.docker.com/library/alpine:latest. Docker Name and Version will auto-populate. (Tip: do not add http:// or https:// in your URL)

Do not use :latest when the repository has rate limiting enabled as this interferes with caching and incurs additional data transfer.

  1. (Optional) Complete the Description field.

  2. Click Save.

  3. The newly added image will appear in your Docker Repository list. You can differentiate between internal and external images by looking at the Source column. If this column is not visible, you can add it with the columns icon ().

Verification of the URL is performed during execution of a pipeline which depends on the Docker image, not during configuration.

External images are accessed from the external source whenever required and not stored in Platform Core. Therefore, it is important not to move or delete the external source. There is no status displayed on external Docker repositories in the overview as Platform Core cannot guarantee their availability.

The use of :stable instead of :latest is recommended.

Importing a Private Image (Tools + Bench Images)

In order to use private images in your tool, you must first upload them as a TAR file.

  1. Navigate to Projects > your_project .

  2. Upload your private image as a TAR file, either by dragging and dropping the file in the Data tab, using the CLI or a Connector. For more information please refer to project Data.

  3. Select your uploaded TAR file and click in the top menu on Manage > Change Format .

  4. Select DOCKER from the drop-down menu and Save.

  5. Navigate to System Settings > Docker Repository (outside of your project).

  6. Click on Create > Image.

  7. Click on the Docker image field. Select the TAR file from the desired region.

  1. Provide a name and version for your Docker image, this will automatically populate the global URL field.

  2. Select the appropriate region, determine the type (tool or bench image), the cluster compatibility (only available for bench images), access method and click Save.

  3. The newly added image should appear in your Docker Repository list. Verify it is marked as Available under the Status column to ensure it is ready to be used in your tool or pipeline.

Copying Docker Images to other Regions

  1. Navigate to System Settings > Docker Repository.

  2. Either

    • Select the required image(s) and go to Manage > Add Region. Select the desired active region and chose Add.

    • OR open the image details, check the box matching the active region you want to add, and select save.

  3. In both cases, allow a few minutes for the image to become available in the new region (the status becomes available in table view).

To remove regions, go to Manage > Remove Region or unselect the regions from the Docker image detail view.

Downloading Docker Images

You can download your created Docker images at System Settings > Docker Images > your_Docker_image > Manage > Download.

In order to be able to download Docker images, the following requirements must be met:

  • The Docker image can not be from an entitled bundle.

  • Only self-created Docker images can be downloaded.

  • The Docker image must be an internal image and in status Available.

  • You can only select a single Docker image at a time for download.

  • You need a with a download rule to download the Docker image.

Deleting Docker Images

When you no longer need a specific Docker image, go to System Settings > Docker Images > your_Docker_image > Manage > Delete. A check is performed to see if this Docker image is still used in any workspaces. Depending on your user rights, you may not get the delete option or be presented with a warning indicating in how many workspaces the Docker image is still being used Proceeding with the deletion will invalidate the workspaces which use this image.

Docker images are not physically deleted, but get marked as deleted. You can still see them if you select Show deleted Docker images in the System Settings > Docker Images view.

File Size Considerations

Docker image size should be kept as small as practically possible. To this end, it is best practice to compress the image. After compressing and uploading the image, select your uploaded file and click Manage > Change Format in the top menu to change it to Docker format so Platform Core can recognize the file.

Non-Indexed Folders

Non-indexed folders () are designed for optimal performance in situations where no file actions are needed. They serve as fast storage in situations like temporary analysis file storage where you don't need access or searches via the GUI to individual files or subfolders within the folder. Think of a non-indexed folder as a data container. You can access the container which contains all the data, but you can not access the individual data files within the container from the GUI. As non-indexed folders contain data, they count towards your total project storage.

You can see the size of a non-indexed folder as part of the data details screen (Projects > your_project > Data > your_non-indexed_data > Data details tab) and in the data view (Projects > your_project > Data).

The GUI considers non-indexed folders as a single object. You can access the contents from a non-indexed folder

Activity

The Activity view (Projects > your_project > Activity) shows the status and history of long-running activities including Data Transfers, Base Jobs, Base Activity, Bench Activity and Batch Jobs.

Data Transfers

The Data Transfers tab shows the status of data uploads and downloads. You can sort, search and filter on various criteria and export the information. Show ongoing transfers (top right) allows you to filter out the completed and failed transfers to focus on current activity.

Transfers with a yellow background indicate that service connector rules have been modified in ways that prevent planned files from being uploaded. Please verify your service connectors to resolve this.

Base Jobs

The Base Jobs tab gives an overview of all the actions related to a table or a query that have run or are running (e.g., Copy table, export table, Select * from table, etc.) If a job is still running, you can abort it from this screen

The jobs are shown with their:

  • Creation time: When did the job start

  • Description: The query or the performed action with some extra information

  • Type: Which action was taken

  • Status: Failed or succeeded

  • Duration: How long the job took

  • Billed bytes: The used bytes that need to be paid for

Failed jobs provide information on why the job failed. Click the job to see more details. If a job is retried, the original failed job will still remain visible here.

The Base Activity tab gives an overview of previous results (e.g., Executed query, Succeeded Exporting table, Created table, etc.) Collecting this information may take some time. For performance reasons, only the activity of the last month (rolling window) with a limit of 1000 records is shown.

You can use the Export function at the bottom of the screen to download the current page or selected rows in Excel, JSV or JSON format.

To get the data for the last year without limit on the number of records, use the export to project file function at the top of the screen. This will export the data in JSON format as either a single file or split over multiple files according to your desired file size. No activity data is retained for more than one year.

The activities are shown with:

  • Start Time: The moment the action was started

  • Query: The SQL expression.

  • Status: Failed or succeeded

The Bench Activity tab shows the actions taken on Bench Workspaces in the project.

The activities are shown with:

  • Workspace: Workspace where the activity took place

  • Date: Date and time of the activity

  • User: User who performed the activity

The Batch Jobs tab allows users to monitor progress of Batch Jobs in the project. It lists Data Downloads, Sample Creation (double-click entries for details) and Data Linking (double-click entries for details). The (ongoing) Batch Job details are updated each time they are (re)opened, or when the refresh button is selected at the bottom of the details screen. Batch jobs which have a final state such as Failed or Succeeded are removed from the activity list after 7 days.

Which batch jobs are visible depends on the user role.

Reference Data

Reference Data are reference genome sets which you use to help look for deviations and to compare your data against.

Creating Reference Data

Reference data properties are located at the main navigation level and consist of the following free text fields.

  • Types

  • Species

  • Reference Sets

Once these are configured,

  1. Go to your data in Projects > your_project > Data.

  2. Select the data you want to use as reference data and Manage > Use as reference data.

  3. Fill out the configuration screen

You can see the result at the main navigation level > Reference Data (outside of projects) or in Projects > your_project > Flow > Reference Data.

Linking Reference Data to your Project

To use a reference set from within a project, you have first to add it. Select Projects > your_project > Flow > Reference Data > Link. Then select a reference set to add to your project.

Reference sets are only supported in Graphical CWL pipelines.

Copying Reference Data to other Regions

  1. Navigate to Reference Data (Not from within a project, but outside of project context, so at the main navigation level).

  2. Select the data set(s) you wish to add to another region and select Copy to another project.

  3. Select a project located in the region where you want to add your reference data.

  4. You can check in which region(s) Reference data is present by opening the Reference set and viewing Copy Details.

  5. Allow a few minutes for new copies to become available before use.

You only need one copy of each reference data set per region. Adding Reference Data sets to additional projects set in the same region does not result in extra copies, but creates links instead. This is done from inside the project at Projects > <your_project> > Flow > Reference Data > Manage > Add to project.

Creating a Pipeline with Reference Data

To create a pipeline with a reference data, use the CWL - graphical mode. Projects > your_project > Flow > Pipelines > +Create > CWL Graphical. Use the reference data icon instead of regular input icon. On the right hand side use the Reference files submenu to specify the name, the format, and the filters. You can specify the options for an end-user to choose from and a default selection. You can select more than 1 file, but you can only select 1 at a time (so, repeat process to select multiple reference files). If you only select 1 reference file, that file will be the only one users can use with your pipeline. In the screenshot a reference data with two options is presented.

Safari is not supported for graphical CWL data.

Two options for a reference file

If your pipeline was built to give users the option of choosing among multiple input reference files, they will see the option to select among the reference files you configured, under Settings. After clicking the magnifying glass icon the user can select from provided options.

onRender.js

Receives an input object which contains information about the current state of the input form, the chosen values and the field value change that triggered the onrender call. It also contains pipeline information. Changed objects are present in the onRender return value object. Any object not present is considered to be unmodified. Changing the storage size in the start analysis screen triggers an onRender execution with storageSize as changed field.

onSubmit.js

The onSubmit.js javascript function receives an input object which holds information about the chosen values of the input form and the pipeline and pipeline execution request parameters. This javascript function is not only triggered when submitting a new pipeline execution request in the user interface, but also when submitting one through the rest API..

Value
Meaning

Base

Base is a genomics data aggregation and knowledge management solution suite. It is a secure and scalable integrated genomics data analysis solution which provides Information management and knowledge mining. You can analyze, aggregate and query data for new insights that can inform and improve diagnostic assay development, clinical trials, patient testing and patient care. Clinically relevant data needs to be generated and extracted from routine clinical testing and clinical questions need to be asked across all data and information sources. As a large data store, Base provides a secure and compliant environment to accumulate data, allowing for efficient exploration of the aggregated data. This data consists of test results, patient data, metadata, reference data, consent and QC data.

Base can be used by for different use cases:

  • Clinical and Academic Researchers:

Schedule

On the Schedule page at Projects > your_project > Base > Schedule, it’s possible to create a job for importing different types of data you have access to into an existing table.

When creating or editing a schedule, Automatic import is performed when the Active box is checked. The job will run at 10 minute intervals. In addition, for both active and inactive schedules, a manual import is performed when selecting the schedule and clicking the »run button.

There are different types of schedules that can be set up:

  • Files

Snowflake

User

Every Base user has 1 snowflake username: ICA_U_<id>

User/Project-Bundle

For each user/project-bundle combination a role is created: ICA_UR_<id>_<name project/bundle>__<id>

This role receives the viewer or contributor role of the project/bundle, depending on their permissions in Platform Core.

Roles

Every project or bundle has a dedicated Snowflake database.

For each database, 2 roles are created:

  • <project/bundle name>_<id>_VIEWER

  • <project/bundle name>_<id>_CONTRIBUTOR

Project viewer role

This role receives

  • REFERENCE and SELECT rights on the tables/views within the project's PUBLIC schema.

  • Grants on the viewer roles of the bundles linked to the project.

Project contributor role

This role receives the following rights on current an future objects in the project's/bundle database in the PUBLIC schema:

  • ownership

  • select, insert, update, delete, truncate and references on tables/views/materialized views

  • usage on sequences/functions/procedures/file formats

  • write, read and usage on stages

  • select on streams

  • monitor and operate on tasks

It also receives grant on the viewer role of the project.

Warehouses

For each project (not bundle!) 2 warehouses are created, whose size can be changed in Platform Core at projects > your_project > project settings > details.

  • <projectname>_<id>_QUERY

  • <projectname>_<id>_LOAD

Using Load instead of Query warehouse

When you generate an oauth token, Platform Core always uses the QUERY warehouse by default (see bold part below):

snowsql -a iap.us-east-1 -u ICA_U_277853 --authenticator=oauth -r ICA_UR_274853_603465_264891 -d atestbase2_264891 -s PUBLIC -w ATESTBASE2_264891_QUERY --token=<token>

If you wish to use the LOAD warehouse in a session, you have 2 options :

Synchronizing Tables

if you have created tables directly in Snowflake with the OAuth token, you can synchronize them to appear in Platform Core by means of the Projects > your_project > Base > Tables > Sync button.

Bench

Platform Core provides a tool called Bench for interactive data analysis. This is a sandboxed workspace which runs a docker image with access to the data and pipelines within a project. This workspace runs on the Amazon S3 system and comes with associated processing and provisioning costs. It is therefore best practice to not keep your Bench instances running indefinitely, but stopping them when not in use.

Access

To access Bench, the following requirements must be met:

  • Bench is included in all subscriptions.

  • The project owner needs to enable Bench for their project.

  • The project owner needs to give access to Bench to Individual users of that project.

Enabling Bench for your project

After creating a project, go to Projects > your_project > Bench > Workspaces page and click the Enable button. The entitlements you have determine the available resources for your Bench workspaces. If you have multiple entitlements, all the resources of your individual entitlements are taken into account. Once bench is enabled, users with matching permissions have access to the Bench module in that project.

If you do not see the Enable button for Bench, then the tenant to which you belong is not the one where the project was created. Users from other tenants can create workspaces in Bench once Bench is enabled, but they cannot enable the Bench module itself.

Setting user level access.

Once Bench has been enabled for your project, the combination of roles and teams settings determines if a user can access Bench.

  • Tenant administrators and project owners are always able to access Bench and perform all actions.

  • The teams settings page at Projects > your_project > Project Settings > Team determines the role for the user/workgroup.

    • No Access means you have no access to the Bench workspace for that project.

    • Contributor gives you the right to start and stop the Bench workspace and to access the workspace contents, but not to create or edit the workspace.

    • Administrator gives you the right to create, edit, delete, start and stop the Bench workspace, and to access the actual workspace contents. In addition, the administrator can also build new derived Bench images and tools.

  • Finally, a verification is done of your user rights against the required workspace permissions. You will only have access when your user rights meet or exceed the required workspace permissions. The possible required Workspace permissions include:

    • Upload / Download rights (Download rights are mandatory for technical reasons)

    • Project Level (No Access / Data Provider / Viewer / Contributor)

Flow diagram of access to Bench

Spark on Platform Core Bench

Running a Spark application in a Bench Spark Cluster

Running a pyspark application

The JupyterLab environment is by default configured with 3 additional kernels

  • PySpark – Local

  • PySpark – Remote

  • PySpark – Remote – Dynamic

When one of the above kernels is selected, the spark context is automatically initialised and can be accessed using the sc object.

PySpark - Local

The PySpark - Local runtime environment launches the spark driver locally on the workspace node and all spark executors are created locally on the same node. It does not require a spark cluster to run and can be used for running smaller spark applications which don’t exceed the capacity of a single node.

The spark configuration can be found at /data/.spark/local/conf/spark-defaults.conf.

Making changes to the configuration requires a restart of the Jupyter kernel.

PySpark - Remote

The PySpark – Remote runtime environment launches the spark driver locally on the workspace node and interacts with the Manager for scheduling tasks onto executors created across the Bench Cluster.

This configuration will not dynamically spin up executors, hence it will not trigger the cluster to auto scale when using a Dynamic Bench cluster.

The spark configuration can be found at /data/.spark/remote/conf/spark-defaults.conf.

Making changes to the configuration requires a restart of the Jupyter kernel.

PySpark – Remote - Dynamic

The PySpark – Remote - Dynamic runtime environment launches the spark driver locally on the workspace node and interacts with the Manager for scheduling tasks onto executors created across the Bench Cluster.

This configuration will increase/decrease the required executors which will result into a cluster that auto scales using a Dynamic Bench cluster

The spark configuration can be found at /data/.spark/remote/conf-dynamic/spark-defaults.conf.

Making changes to the configuration requires a restart of the Jupyter kernel.

Job resources

Every cluster member has a certain capacity depending on the selection of the Resource model for the member.

A spark application consists of 1 or more jobs. Each Job consists out of one or more stages. Each stage consists out of one or more tasks. Task are handled by executors and executors are run on a worker (cluster member).

The following setting define the amount of cpus needed per task

spark.task.cpus 1

The following settings define the size of a single executor which handles the execution of a task

spark.executor.cores 4 
spark.executor.memory 4g

The above example allows an executor to handle 4 tasks concurrently and share a total capacity of 4Gb of memory. Depending on the resource model chosen (e.g. standard-2xlarge) a single cluster member (worker node) is able to run multiple executors concurrently (e.g. 32 cores, 128 Gb for 8 concurrent executors on a single cluster member)

Spark User Interface

The Spark UI can be accessed via the Cluster. The Web Access URL is displayed in the Workspace details page

This Spark UI will register all applications submitted when using one of the Remote Jupyter kernels. It will provide an overview of the registered workers (Cluster members) and the applications running in the Spark cluster.

Spark Reference documentation

See the apache website

Run DRAGEN in Bench - Interactive

DRAGEN can run in workspaces

  • On FPGA-instances, DRAGEN can run in FPGA mode (hardware-accelerated) or software mode. This can be useful when comparing performance gains by hardware acceleration or to distribute concurrent processes between the FPGA and cpu.

  • On non-FPGA instances DRAGEN can only run in software mode.

The DRAGEN command line parameters to specify the location of the licence file are different.

Cohorts

Introduction to Cohorts

Cohorts is a cohort analysis tool integrated with Illumina BioInsight Platform Core. Cohorts combines subject- and sample-level metadata, such as phenotypes, diseases, demographics, and biometrics, with molecular data stored in Platform Core to perform tertiary analyses on selected subsets of individuals.

Overview Video

This video is an overview of Illumina BioInsight Platform Core. It walks through a Multi-Omics Cancer workflow that can be found here: Oncology Walkthrough

Features At-a-glance

  • Intuitive UI for selecting subjects and samples to analyze and compare: deep phenotypical and clinical metadata, molecular features including germline, somatic, gene expression.

  • Comprehensive, harmonized data model exposed to Platform Core Base and Platform Core Bench users for custom analyses.

  • Run analyses in Platform Core Base and Platform Core Bench and upload final results back into Cohorts for visualization.

  • Out-of-the-box statistical analyses including genetic burden tests, GWAS/PheWAS.

  • Rich public data sets covering key disease areas to enrich private data analysis.

  • Easy-to-use visualizations for gene prioritization and genetic variation inspection.

Functionality

  • Create a Cohort

  • Import New Samples

  • Prepare Metadata Sheets

  • Precomputed GWAS and PheWAS

Walk-throughs

  • Oncology

  • Rare Genetic Disorders

Public Data Sets

Cohorts contains a variety of freely available data sets covering different disease areas and sequencing technologies. For a list of currently available data, see here.

Compare Cohorts

You can compare up to four previously created individual cohorts, to view differences in variants and mutations, RNA expression, copy number variation, and distribution of clinical attributes. Once comparisons are created, they are saved in the Comparisons left-navigation tab of the Cohorts module.

  1. Select Cohorts from the left-navigation panel.

  2. Select 2 to 4 cohorts already created. If you have not created any cohorts, See Create a Cohort documentation.

Rare Genetic Disorders Walk-through

This walk-through is meant to represent a typical workflow when building and studying a cohort of rare genetic disorder cases.

Create a new Project to track your study:

  1. Log in to Platform Core

  2. Navigate to Projects.

Details

The project details page contains the properties of the project, such as the location, owner, storage and linked bundles. This is also the place where you add assets in the form of linked .

The project details are configured during project creation and may be updated by the project owner, entities with the project Adminstrator role, and tenant administrators.

  1. Click the Edit button at the top of the Details page.

  2. Click the + button, under LINKED BUNDLES.

Nextflow Pipeline

In this tutorial, we will show how to create and launch a pipeline using the Nextflow language in Platform Core.

This tutorial references the Basic pipeline example in the Nextflow documentation.

Create the pipeline

The first step in creating a pipeline is to create a Project. In the example below, the project is named Getting Started.

Pipeline

After creating your project,

  1. Open the project at Projects > your_project.

  2. Navigate to the Flow > Pipelines view in the left navigation pane.

  3. From the Pipelines view, click +Create > Nextflow > XML based to start creating the Nextflow pipeline.

In the Nextflow pipeline creation view, the Description field is used to add information about the pipeline. Add values for the required Code (unique pipeline name), description and size fields.

Nextflow Files

Next a Nextflow pipeline definition must be created. The pipeline in this example is a modified version of the Basic pipeline example from the Nextflow documentation.

The description of the pipeline from the linked Nextflow docs:

This example shows a pipeline that is made of two processes. The first process receives a FASTA formatted file and splits it into file chunks whose names start with the prefix seq_.

The process that follows, receives these files and reverses their content by using the rev command line tool.

Some modifications are made to the Nextflow pipeline, you do not need to copy these modification by hand. Copyable code is provided below.

  • Adding the container directive to each process with the desired ubuntu image. If no Docker image is specified, public.ecr.aws/lts/ubuntu:22.04_stable is used as default. If you want to use the latest image, use container 'public.ecr.aws/lts/ubuntu:latest'

  • Adding the publishDir directive with value 'out' to the reverse process.

  • Modifying the reverse process to write the output to a file test.txt instead of stdout.

  • Creating a channel with the input file.

Setting Process Resources: For each process, you can use the memory directive and cpus directive to set the Compute Types. Platform Core will then determine the best matching compute type based on those settings. Suppose you set memory '10240 GB' and cpus 6, then Platform Core will determine you need the standard-large compute type.

Syntax example:

process iwantstandardsmallresources {
    cpus 2
    memory '8 GB'
    ...

Navigate to the Nextflow files > main.nf tab to add the definition to the pipeline. Since this is a single file pipeline, we don't need to add any additional definition files. Paste the following definition into the text editor:

#!/usr/bin/env nextflow
params.in = "$HOME/sample.fa"

// -----------------------------
// Processes
// -----------------------------

// Split the file
process splitSequences {
    container 'public.ecr.aws/lts/ubuntu:latest'

    input:
    path 'input_fa'

    output:
    path "seq_*"

    script:
    """
   awk '/^>/{f="seq_"++d} {print > f}' < ${input_fa}
    """
}

// Reverse the Sequence
process reverse {
    container 'public.ecr.aws/lts/ubuntu:latest'
    publishDir 'out'

    input:
    path x

    output:
    path "test.txt"

    script:
    """
    cat ${x} | rev > test.txt
    """
}

// -----------------------------
// Workflow block
// -----------------------------

workflow {
//     Create a channel with your input file
    sequences = Channel.fromPath(params.in)
    splitSequences(sequences) | reverse | view
}

Input Form

Next create the input form used when launching the pipeline. This is done in the XML Configuration tab. Since the pipeline takes in a single FASTA file as input, the input form includes a single file input.

Paste the below XML input form into the XML CONFIGURATION text editor

<?xml version="1.0" encoding="UTF-8" standalone="yes"?>
<pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition">
    <pd:dataInputs>
        <pd:dataInput code="in" format="FASTA" type="FILE" required="true" multiValue="false">
            <pd:label>in</pd:label>
            <pd:description>fasta file input</pd:description>
        </pd:dataInput>
    </pd:dataInputs>
    <pd:steps/>
</pd:pipeline>

On the left, you see the XML code, on the right, you can see the input form simulation which appears when you use the simulate button at the bottom.

Once the definition has been added and the input form has been defined, the pipeline is complete.

On the Documentation tab, you can add additional information about your pipeline. This information will be presented under the Documentation tab whenever a user starts a new analysis on the pipeline.

Click the Save button at the top right. The pipeline will now be visible from the Projects > your_project > Pipelines view within the project.

Launch the pipeline

Before launching the pipeline, upload a FASTA file to use as input. For this tutorial, use a public FASTA file from the UCSC Genome Browser. Download chr1_GL383518v1_alt.fa.gz and unzip yjr FASTA file to decompress it.

To upload the FASTA file to the project, navigate to Projects > your_project > Data. In the Data view, drag and drop the FASTA file from your local machine in the input section (2) in the browser. Once the file upload completes, the file record will show in the Data explorer. The file format should be auto-detected and be FASTA. If this is not the case, you can set it by hand by selecting the file and changing the format from the manage menu item.

Now that the input data is uploaded, we can proceed to launch the pipeline. Navigate to Projects > your_project > Flow > Analyses click on Start. Next, select your pipeline from the list.

Alternatively you can start your pipeline from Projects > your_project > Flow > Pipelines > your_pipeline > Start analysis.

In the Launch Pipeline view, the input form fields are shown along with some required information to create the analysis.

With the required information set, click Start Analysis.

Monitoring Analysis

After launching the pipeline, navigate to Projects > your_project > Flow > Analysis.

The analysis record will be visible from the Analyses view. The Status will transition through the analysis states as the pipeline progresses. It may take some time (depending on resource availability) for the environment to initialize and the analysis to move to the In Progress status. Once the pipeline succeeds, the analysis record will show Succeeded as status.

This may take considerable time if it is your first analysis due to the required resource management.

Once the analysis has succeeded, click the analysis details tab for more information.

From the analysis details view, the logs produced by each process within the pipeline are accessible via the Steps tab.

View Results

Analysis outputs are written to an output folder in the project with the naming convention {Analysis User Reference}-{Pipeline Code}-{GUID}. (1)

Inside of the analysis output folder are the files generated by the analysis processes written to the out folder. In this tutorial, the file test.txt (2) is written to by the reverse process. Navigating to the analysis output folder, opening the test.txt file details, and selecting the VIEW tab (3) shows the output file contents.

Use the download button (4) if you want to download the data to the local machine.

Nextflow: Scatter-gather Method

Nextflow supports scatter-gather patterns natively through Channels. The initial uses this pattern by splitting the FASTA file into chunks to channel records in the task splitSequences, then by processing these chunks in the task reverse.

In this tutorial, we will create a pipeline which will split a TSV file into chunks, sort them, and merge them together.

Select Projects > your_project > Flow > Pipelines. From the Pipelines view, click the +Create > Nextflow > XML based button to start creating a Nextflow pipeline.

In the Details tab, add values for the required Code (unique pipeline name) and Description fields. Nextflow Version and Storage size defaults to preassigned values.

Change the name in the connect string : snowsql -a iapdev.us-east-1 -u ICA_U_277853 --authenticator=oauth -r ICA_UR_277853_603465_264891 -d atestbase2_264891 -s PUBLIC -w ATESTBASE2_264891_LOAD`` ``--token=<token>
  • Execute the following statement after logging in : “use warehouse ATESTBASE2_264891_LOAD”

  • To determine which warehouse you are using, execute : select current_warehouse();

    Duration: How long the job took
  • User: The user that requested the action

  • Size: For SELECT queries, the size of the query results is shown. Queries resulting in less than 100Kb of data will be shown with a size of <100K

  • Action: Which activity was performed

    Project Creator

    Project Collaborator same tenant

    Project Collaborator different tenant

    All batch jobs

    All batch jobs

    Only batch jobs of own tenant

    Base Activity

    Bench Activity

    Batch Jobs

    Click on the desired bundle, then click the +Link Bundles button.
  • Click Save.

  • From the Region drop-down list, select where the assets for this bundle should be stored.
  • Set the status of the bundle. When the status of a bundle changes, it cannot be reverted to a draft or released state.

    • Draft—The bundle can be edited.

    • Released—The bundle is released. Technically, you can still edit bundle information and add assets to the bundle, but should refrain from doing so.

    • Deprecated—The bundle is no longer intended for use. By default, deprecated bundles are hidden on the main Bundles screen (unless non-deprecated versions of the bundle exist). Select "Show deprecated bundles" to show all deprecated bundles. Bundles can not be recovered from deprecated status.

  • [optional] Configure the following settings.

    • Categories—Select an existing category or enter a new one.

    • Short Description—Enter a description for the bundle.

    • Metadata Model—Select a metadata model to apply to the bundle.

  • Enter a release version for the bundle and optionally enter a description for the version.

  • [Optional] Links can be added with a display name (max 100 chars) and URL (max 2048 chars).

    • Homepage

    • License

    • Links

    • Publications

  • [Optional] Enter any information you would like to distribute with the bundle in the Documentation section.

  • Select Save.

  • Select Save.

  • Select the assets and confirm with the link button..
    Pipelines and tools need to be in released status.
  • Samples must be available in a complete state.

  • Tables can not be linked to a bundle while Base creation for that bundle is in progress.

  • update the version number
    .
  • Select Save.

  • Use the editor to define Terms of Use for the selected bundle.
  • Click Save.

  • [Optional] Require acceptance by clicking the checkbox next to Acceptance required. Acceptance required will prompt a user to accept the Terms of Use before being able to use a bundle or add the bundle to a project.

  • To edit the Terms of Use, repeat Steps 1-3 and use a unique version name. If you select acceptance required, you can choose to keep the acceptance status as is or require users to reaccept the terms of use. When reacceptance is required, users need to reaccept the terms in order continue using this bundle in their pipelines. This is indicated when they want to enter projects which use this bundle.

  • To add a user by their email address, select By email and enter their email address.
  • To add all the users of an entire workgroup, select Add workgroup and select a workgroup from the drop-down list.

  • Select the Bundle Role drop-down list and choose a role for the user or workgroup. This role defines the ability of the user or workgroup to view or edit bundle settings.

    • Viewer: view content without editing rights.

    • Contributor: view bundle content and link/unlink assets.

    • Administrator: full edit rights of content and configuration.

  • Repeat as needed to add more users.

  • Users are not officially added to the bundle until they accept the invitation.

  • To change the permissions role for a user, select the Bundle Role drop-down list for the user and select a new role.

  • To revoke bundle permissions from a user, select the trash icon for the user.

  • Select Save Changes.

  • Click on the desired bundle, then click the +Link Bundles button.
  • Click Save.

  • Some bundles come with additional restrictions such as disabling bench access or internet access when running pipelines to protect the data contained in them. When you link these bundles, the restrictions will be enforced on your project. Unlinking the bundle will not remove the restrictions.

    You can not link bundles which come with additional restrictions to externally managed projects.

    As of Platform Core v.2.29, the content in bundles is linked in such a way that any updates to a bundle are automatically propagated to the projects which have that bundle linked.

    If you have created bundle links in Platform Core versions prior to Platform Core v2.29 and want to switch them over to links with dynamic updates, you need to unlink and relink them.

    Linking an Existing Bundle to a Project

    Bundles and projects have to be in the same region in order to be linked. Otherwise, the error The bundle is in a different region than the project so it's not eligible for linking will be displayed.

    The owning tenant of a project must have access to a bundle if you want to link that bundle to the project. You do not carry your access to a bundle over if you are invited to projects of other tenants.

    When linking a bundle which includes Base to a project that does not have Base enabled, there are two possibilities:

    • Base is not allowed due to entitlements: The bundle will be linked and you will be given access to the data, pipelines, samples,... but you will not see the Base tables in your project.

    • Base is allowed, but not yet enabled for the project. The bundle will be linked and you will be given access to the data, pipelines, samples,...but you will not see the Base tables in your project and Base remains disabled until you enable it.

    You can not unlink bundles which were linked by external applications

    Create a New Bundle

    There is no option to delete bundles, they must be deprecated instead.

    To cancel creating a bundle, select Bundles from the navigation at the top of the screen to return to your bundles overview.

    Edit an Existing Bundle

    When the changes are saved, they also become available in all projects that have this bundle linked.

    Adding Assets to a Bundle

    You can not add the same asset twice to a bundle. Once added, the asset will no longer appear in the asset selection list.

    You need to be in list view in order to unlink items from a bundle. Select the item and choose the unlink action at the top of the screen.

    Create a New Bundle Version

    Add Terms of Use to a Bundle

    Collaborating on a Bundle

    Sharing a Bundle

    Do not to create duplicate entries. You can only use one user/tenant combination per bundle.

    Entitled Bundles

    Reference Data
    Pipelines
    Tools
    Tool images
    Base tables
    Base query templates
    Bench docker images
    Access and Use an Entitled Bundle
    project
    service connector
    Flow (No Access / Viewer / Contributor)
  • Base (No Access / Viewer / Contributor)

  • Big data storage solution housing all aggregated sample test outcomes

  • Analyze information by way of a convenient query formalism

  • Look for signals in combined phenotypic and genotypic data

  • Analyze QC patterns over large cohorts of patients

  • Securely share (sub)sets of data with other scientists

  • Generate reports and analyze trends in a straightforward and simple manner.

  • Bioinformaticians:

    • Access, consult, audit, and query all relevant data and QC information for tests run

    • All accumulated data and accessible pipelines can be used to investigate and improve bioinformatics for clinical analysis

    • Metadata is captured via automatic pipeline version tracking, including information on individual tools and/or reference files used during processing for each sample analyzed, information on the duration of the pipeline, the execution path of the different analytical steps, or in case of failure, exit codes can be warehoused.

  • Product Developers and Service Providers:

    • Better understand the efficiency of kits and tests

    • Analyze usage, understand QC data trends, improve products

    • Store and aggregate business intelligence data such as lab identification, consumption patterns and frequency, as well as allow renderings of test result outcome trends and much more.

    • Data Warehouse Creation: Build a relational database for your Project in which desired data sets can be selected and aggregated. Typical data sets include pipeline output metrics and other suitable data files generated by the Platform Core platform which can be complemented by additional public (or privately built) databases.

    • Report and Export: Once created, a data warehouse can be mined using standard database query instructions. All Base data is stored in a structured and easily accessible way. An interface allows for the selection of specific datasets and conditional reporting. All queries can be stored, shared, and re-used in the future. This type of standard functionality supports most expected basic mining operations, such as variant frequency aggregation. All result sets can be downloaded or exported in various standard data formats for integration in other reporting or analytical applications.

    • Detect Signals and Patterns: extensive and detailed selection of subsets of patients or samples adhering to any imaginable set of conditions is possible. Users can, for example, group and list subjects based on a combination of (several) specific genetic variants in combination with patient characteristics such as therapeutic (outcome) information. The built-in integration with public datasets allows users to retrieve all relevant publications, or clinically significant information for a single individual or a group of samples with a specific variant. Virtually any possible combination of stored sample and patient information allow for detecting signals and patterns by a simple single query on the big data set.

    • Profile/Cluster patients: use and re-analyze patient cohort information based on specific sample or individual characteristics. For instance, they might want to run a next agile iteration of clinical trials with only patients that respond. Through integrated and structured consent information allowing for time-boxed use, combined with the capability to group subjects by the use of a simple query, patients can be stratified and combined to export all relevant individuals with their genotypic and phenotypic information to be used for further research.

    • Share your data: Data sharing is subject to strict ethical and regulatory requirements. Base provides built-in functionality to securely share (sub)sets of your aggregated data with third parties. All data access can be monitored and audited, in this way Base data can be shared with people in and outside of an organization in a compliant and controlled fashion.

    The Base module can be found at Projects > your_project > Base. In order to use Base, you need to meet the following requirements:

    Base is included in all subscriptions.

    Once a project is created, the project owner must navigate to Projects > your_project > Base and click the Enable button. From that moment on, every user who has the proper permissions has access to the Base module in that project. While base creation for the project is ongoing, there will be an indication of this when trying to access Projects > your_project > Base > Tables.

    Access to the projects and Base is configured on the Projects > your_project > Project settings > Team page. Here you can add or edit a user or workgroup and give them Bench access.

    The status and history of Base activities and jobs are shown on the Activity page.

    Introduction to Base

    Use Cases

    Base Action Possibilities

    Access

    Subscription

    Enabling Base

    Enabling User Access

    Activity

    Click Compare Cohorts in the right-navigation panel.

  • Note you are now in the Comparisons left-navigation tab of the Cohorts module.

  • In the Charts section, if the COHORTS item is not displayed, click the gear icon in the top right and add Cohorts as the first attribute and click Save.

  • The COHORTS item in the charts panel will provide a count of subjects in each cohort and act as a legend for color representation throughout comparison screens.

  • For each clinical attribute category, a bar chart is displayed. Use the gear icon to select attributes to display in the charts panel.

    1. Select the Attributes tab

    2. Attribute categories are listed and can be expanded using the down-arrows next to the category names. The categories available are based on cohorts selected. Categories and attributes are part of the Platform Core Cohorts metadata template that map to each Subject.

    3. For example, use the drop-down arrow next to Vital status to view sub-categories and frequencies across selected cohorts.

    1. Select the Genes tab

    2. Search for a gene of interest using its HUGO/HGNC gene symbol

    3. Variants and mutations will be displayed as one needle plot for each cohort that is part of the comparison (see Genes for more details)

    4. As additional filter options, you can view only those variants that are occur in every cohort; that are unique to one cohort; that have been observed in at least two cohorts; or any variant.

    1. Select the Survival Summary tab.

    2. Attribute categories are listed and can be expanded using the down-arrows next to the category names.

    3. Select the drop-down arrow for Therapeutic interventions.

    4. In each subcategory there is a sum of the subject counts across select cohorts.

    5. For each cohort, designated by a color, there is a Subject count and Median survival (years) column.

    6. Type Malignancy in the Search Box and an auto-complete dropdown suggests three different attributes.

    7. Select Synchronous malignancy and the results are automatically opened and highlighted in orange.

    1. Click Survival Comparison tab.

    2. A Kaplan-Meier Curve is rendered based on each cohort.

    3. P-Value Displayed at the top of Survival Comparison indicates whether there is statistically significant variance between survival probabilities over time of any pair of cohorts (CI=0.95).

    1. Select the Marker Frequency tab.

    2. Select either Gene expression (default), Somatic mutation, or Copy number variation

    3. For gene expression (up- versus down-regulated) and for copy number variation (gain versus loss), Cohorts will display a list of all genes with bidirectional barcharts

    4. For somatic mutations, the barcharts are unidirectional and indicate the percentage of samples with a mutation in each gene per cohort.

    5. Bars are color-coded by cohort, see the accompanying legend.

    6. Each row shows P-value(s) resulting from pairwise comparison of all cohorts. In the case of comparing two cohorts, the numerical P-value will be displayed in the table. In the case of comparing three or more cohorts, the pairwise P-values are shown as a triangular heatmap, with details available as a tooltip.

    1. Select the Correlation tab.

    2. Similar to the single-cohort view (Cohort Analysis | Correlation), choose two clinical attributes and/or genes to compare.

    3. Depending on the available data types for the two selections (categorical and/or continuous), Cohorts will display a bubble plot, violin plot, or scatter plot.

    Create a comparison view

    You can share a comparison with other team members in the same Platform Core project. Please refer to the section on "Sharing a Cohort" on "Create a Cohort" for details on sharing, unsharing, deleting, and archiving, which are analogous for sharing comparisons.

    Attribute Comparison

    Variants Comparison

    Survival Summary

    Survival Comparison

    When comparing two cohorts, the P-Value is shown above the two survival curves. For three or four cohorts, P-Values are shown as a pair-wise heatmap, comparing each cohort to every other cohort.

    Marker Frequency Comparison

    Correlation Comparison

    pipeline

    Info about the pipeline: code, tenant, and description are all available in the pipeline object as string.

    analysis

    Info about this run: userReference, userName, and userTenant are all available in the analysis object as string.

    storageSize

    The storage size as chosen by the user. This will initially be null. StorageSize is an object containing an 'id' and 'name' property.

    storageSizeOptions

    The list of storage sizes available to the user when creating an analysis. Is a list of StorageSize objects containing an 'id' and 'name' property.

    analysisSettings

    The input form json as saved in the pipeline. So the original json, without eventual changes.

    currentAnalysisSettings

    The current input form JSON as rendered to the user. This can contain already applied changes form earlier onRender passes. Null in the first call, when context is 'Initial' or when analysis is created through CLI/API.

    Value
    Meaning

    settings

    The value of the setting fields. This allows modifying the values or applying defaults and such. Or taking info of the pipeline or analysis input object. When settings are not present in the onSubmit return value object, they are assumed to be not modified.

    validationErrors

    A list of AnalysisError essages representing validation errors. Submitting a pipeline execution request is not possible while there are still validation errors.

    analysisSettings

    The input form json with potential applied changes. The discovered changes will be applied in the UI when viewing the analysis.

    This is the object used for representing validation errors.

    Value
    Meaning

    fieldId / FieldId

    The field which has an erroneous value. When not present, a general error/warning is displayed. To display an error on the storage size, use the storageSizeFieldid.

    index / Index

    The 0-starting index of the value which is incorrect. Use this when a particular value of a multivalue field is not correct. When not present, the entire field is marked as erroneous. The value can also be an array of indexes for use with fieldgroups. For instance, when the 3rd field of the 2nd instance of a fieldgroup is erroneous, a value of [ 1 , 2 ] is used.

    message / Message

    The error/warning message to display.

    settings

    The value of the setting fields. Corresponds to settingValues in the onRender.js. This is a map with field id as key and an array of field values as value. For convenience, values of single-value fields are present as the individual value and not as an array of length 1. In case of fieldGroups, the value can be multiple levels of arrays. For fields of type data the values in the json are data ids (fil.xxxx). To help with validation, these are expanded and made available as an object here containing the id, name, path, format, size and a boolean indicating whether the data is external. This info can be used to validate or pick the chosen storageSize.

    settingValues

    Input parameters

    To maximize the opportunity for reusing code between onRender and onSubmit, the 'settings' are also exposed as settingValues like in the onRender input.

    Return values (taken from the response object)

    AnalysisError

    FPGA mode uses

    Software mode uses

    DRAGEN software is provided in specific Bench images with names starting with Dragen. For example (available versions may vary):

    • Dragen 4.4.1 - Minimal provides DRAGEN 4.4.1 and SSH access

    • Dragen 4.4.6 provides DRAGEN 4.4.6, SSH and JupyterLab.

    The instance type is selected during workspace creation (Projects > your_project > Bench > Workspaces). The amount of RAM available on the instance is critical. 256GiB RAM is a safe choice to run DRAGEN in production. All FPGA2 instances offer 256GiB or more of RAM.

    When running in Software mode, use himem-large (348GiB RAM) or hicpu-large (144 GiB RAM) to ensure enough RAM is available for your runs.

    Using an fpga2-medium instance type.

    Using a standard-xlarge instance type.

    Software mode is activated with the DRAGEN --sw-mode parameter.

    Introduction

    To run DRAGEN in software mode, you need to use the DRAGEN --sw-mode parameter.

    Bench

    DRAGEN Bench Images

    Prerequisites

    Memory

    During pipeline development, when typically using small amounts of data, you can try to scale down in instance types to save costs. You can start at hicpu-large and progressively use smaller instances, though you will need at least standard-xlarge. If DRAGEN runs out of available memory, the system is rebooted, losing your currently running commands and interface.

    DRAGEN version 4.4.6 and later verify if the system has at least 128GB of memory available. If not enough memory is available, you will encounter an error stating that the Available memory is less than the minimum system memory required 128GB. This can be overridden with the command line parameter dragen --min-memory 0

    FPGA-mode

    Example

    Software-mode

    Example

    First, we present the individual processes. Select +Nextflow files > + Create and label the file split.nf. Copy and paste the following definition.

    Next, select +Create and name the file sort.nf. Copy and paste the following definition.

    Select +Create again and label the file merge.nf. Copy and paste the following definition.

    Add the corresponding main.nf file by navigating to the Nextflow files > main.nf tab and copying and pasting the following definition.

    Here, the operators flatten and collect are used to transform the emitting channels. The Flatten operator transforms a channel in such a way that every item of type Collection or Array is flattened so that each single entry is emitted separately by the resulting channel. The collect operator collects all the items emitted by a channel to a List and return the resulting object as a sole emission.

    Finally, copy and paste the following XML configuration into the XML Configuration tab.

    Click the Generate button (at the bottom of the text editor) to preview the launch form fields.

    Click the Save button to save the changes.

    Go to the Pipelines page from the left navigation pane. Select the pipeline you just created and click Start New Analysis.

    Fill in the required fields indicated by red "*" sign and click on Start button. You can monitor the run from the Analyses page. Once the Status changes to Succeeded, you can click on the run to access the results page.

    In Projects > your_project > Flow > Analyses > your_analysis > Steps you can see that the input file is split into multiple chunks, then these chunks are sorted and merged.

    Creating the pipeline

    example

    Running the pipeline

    LICENSE_PARAMS="--lic-instance-id-location /opt/dragen-licence/instance-identity.protected --lic-credentials /opt/dragen-licence/instance-identity.protected/dragen-creds.lic"
    LICENSE_PARAMS="--sw-mode --lic-credentials /opt/dragen-licence/instance-identity.protected/dragen-creds-sw-mode.lic"
    mkdir /data/demo 
    cd /data/demo 
    
    # download ref 
    wget --progress=dot:giga https://s3.amazonaws.com/stratus-documentation-us-east-1-public/dragen/reference/Homo_sapiens/hg38.fa -O hg38.fa 
    # => 0.5min 
    
    # Build ht-ref 
    mkdir ref 
    dragen --build-hash-table true --ht-reference hg38.fa --output-directory ref 
    # => 6.5min 
    
    # run DRAGEN mapper 
    FASTQ=/opt/edico/self_test/reads/midsize_chrM.fastq.gz
    
    # Next line is needed to resolve "run the requested pipeline with a pangenome reference, but a linear reference was provided" in DRAGEN (4.4.1 and others). Comment out when encountering unrecognised option '--validate-pangenome-reference=false'.
    DRAGEN_VERSION_SPECIFIC_PARAMS="--validate-pangenome-reference=false" 
    
    # License Parameters
    LICENSE_PARAMS="--lic-instance-id-location /opt/dragen-licence/instance-identity.protected --lic-credentials /opt/dragen-licence/instance-identity.protected/dragen-creds.lic"
    
    mkdir out
    dragen -r ref --output-directory out --output-file-prefix out -1 $FASTQ --enable-variant-caller false --RGID x --RGSM y ${LICENSE_PARAMS} ${DRAGEN_VERSION_SPECIFIC_PARAMS} 
    # => 1.5min (10 sec if fpga already programmed)
    mkdir /data/demo 
    cd /data/demo 
    
    # download ref 
    wget --progress=dot:giga https://s3.amazonaws.com/stratus-documentation-us-east-1-public/dragen/reference/Homo_sapiens/hg38.fa -O hg38.fa 
    # => 0.5min 
    
    # Build ht-ref 
    mkdir ref 
    dragen --build-hash-table true --ht-reference hg38.fa --output-directory ref 
    # => 6.5min 
    
    # run DRAGEN mapper 
    FASTQ=/opt/edico/self_test/reads/midsize_chrM.fastq.gz
    
    # Next line is needed to resolve "run the requested pipeline with a pangenome reference, but a linear reference was provided" in DRAGEN (4.4.1 and others). Comment out when encountering ERROR: unrecognised option '--validate-pangenome-reference=false'.
    DRAGEN_VERSION_SPECIFIC_PARAMS="--validate-pangenome-reference=false"
    
    # When using DRAGEN 4.4.6 and later, the line above should be extended with --min-memory 0 to skip the memory check.
    DRAGEN_VERSION_SPECIFIC_PARAMS="--validate-pangenome-reference=false --min-memory 0" 
    
    # License Parameters
    LICENSE_PARAMS="--sw-mode --lic-credentials /opt/dragen-licence/instance-identity.protected/dragen-creds-sw-mode.lic" 
    
    mkdir out 
    dragen -r ref --output-directory out --output-file-prefix out -1 $FASTQ --enable-variant-caller false --RGID x --RGSM y ${LICENSE_PARAMS} ${DRAGEN_VERSION_SPECIFIC_PARAMS} 
    # => 2min
    process split {
        container 'public.ecr.aws/lts/ubuntu:25.10'
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'standard-small'
        cpus 1
        memory '512 MB'
        
        input:
        path x
        
        output:
        path("split.*.tsv")
        
        """
        split -a10 -d -l3 --numeric-suffixes=1 --additional-suffix .tsv ${x} split.
        """
        }
    process sort {
        container 'public.ecr.aws/lts/ubuntu:25.10'
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'standard-small'
        cpus 1
        memory '512 MB'
        
        input:
        path x
        
        output:
        path '*.sorted.tsv'
        
        """
        sort -gk1,1 $x > ${x.baseName}.sorted.tsv
        """
    }
    process merge {
        container 'public.ecr.aws/lts/ubuntu:25.10'
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'standard-small'
        cpus 1
        memory '512 MB'
    
        publishDir 'out', mode: 'symlink'
        
        input:
        path x
        
        output:
        path 'merged.tsv'
        
        """
        cat $x > merged.tsv
        """
    }
    nextflow.enable.dsl=2
     
    include { sort } from './sort.nf'
    include { split } from './split.nf'
    include { merge } from './merge.nf'
     
     
    params.myinput = "test.test"
     
    workflow {
        input_ch = Channel.fromPath(params.myinput)
        split(input_ch)
        sort(split.out.flatten())
        merge(sort.out.collect())
    }
    <?xml version="1.0" encoding="UTF-8" standalone="yes"?>
    <pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition" code="" version="1.0">
        <pd:dataInputs>
            <pd:dataInput code="myinput" format="TSV" type="FILE" required="true" multiValue="false">
                <pd:label>myinput</pd:label>
                <pd:description></pd:description>
            </pd:dataInput>
        </pd:dataInputs>
        <pd:steps/>
    </pd:pipeline>

    The input form json as saved in the pipeline. This is the original json, without changes.

    currentAnalysisSettings

    The current input form json as rendered to the user. This can contain already applied changes form earlier onRender passes. Null in the first call, when context is Initial.

    settingValues

    The current value of all settings fields. This is a map with field id as key and an array of field values as value for multivalue fields. For convenience, values of single-value fields are present as the individual value and not as an array of length 1. In case of fieldGroups, the value can be multiple levels of arrays. For fields of type data the values in the json are data ids (fil.xxxx). To help with validation, these are expanded and made available as an object here containing the id, name, path, format, size and a boolean indicating whether the data is external. This info can be used to validate or pick the chosen storageSize.

    pipeline

    Information about the pipeline: code, tenant and description are all available in the pipeline object as string.

    analysis

    Information about this run: userReference, userName, and userTenant are all available in the analysis object as string.

    storageSize

    The storage size as chosen by the user. This will initially be null. StorageSize is an object containing an 'id' and 'name' property.

    storageSizeOptions

    The list of storage sizes available to the user when creating an analysis. Is a list of StorageSize objects containing an 'id' and 'name' property.

    Value
    Meaning

    analysisSettings

    The input form json with potential applied changes. The discovered changes will be applied in the UI.

    settingValues

    The current, potentially altered map of all setting values. These will be updated in the UI.

    validationErrors

    A list of RenderMessages representing validation errors. Submitting a pipeline execution request is not possible while there are still validation errors.

    This is the object used for representing validation errors and warnings. The attributes can be used with first letter lowercase (consistent with the input object attributes) or uppercase.

    Value
    Meaning

    fieldId / FieldId

    The field which has an erroneous value. When not present, a general error/warning is displayed. To display an error on the storage size, use the storageSizeFieldid.

    index / Index

    The 0-starting index of the value which is incorrect. Use this when a particular value of a multivalue field is not correct. When not present, the entire field is marked as erroneous. The value can also be an array of indexes for use with fieldgroups. For instance, when the 3rd field of the 2nd instance of a fieldgroup is erroneous, a value of [ 1 , 2 ] is used.

    message / Message

    The error/warning message to display.

    context

    "Initial"/"FieldChanged"/"Edited".

    • Initial is the value when first displaying the form when a user opens the start run screen.

    • The value is FieldChanged when a field with 'updateRenderOnChange'=true is changed by the user.

    • Edited (Not yet supported in Platform Core) is used when a form is displayed later again, this is intended for draft runs or when editing the form during reruns.

    changedFieldId

    The id of the field that changed and which triggered this onRender call. context will be FieldChanged. When the storage size is changed, the fieldId will be storageSize.

    Input Parameters

    analysisSettings

    Return values (taken from the response object)

    RenderMessage

    as Analysis input/output
  • in Bench

  • via the API

  • Action
    Allowed
    Details

    Creation

    Yes

    You can create non-indexed folders at Projects > your_project > Data > Manage > Create non-indexed folder. or with the /api​/projects​/{projectId}​/data:createNonIndexedFolder

    Deletion

    Yes

    You can delete non-indexed folders by selecting them at Projects > your_project > Data > select the folder > Manage > Delete. or with the /api​/projects​/{projectId}​/data/{dataId}:delete endpoint

    There can be a noticeable delay before the size of a non-indexed folder is updated after changes because of how the data is handled.

    Click on the desired bundle, then click the Link button.

  • Click Save.

  • If your linked bundle contained a pipeline, then it will appear in Projects > your_project > Flow > Pipelines.

    Detail
    Description

    Name

    Name of the project unique within the tenant. Alphanumerics, underscores, dashes, and spaces are permitted.

    Short Description

    Short description of the project

    Project Owner

    Owner of the project (has Administrator access to the project)

    A project's billing mode determines the strategy for how costs are charged to billable accounts.

    Billing Mode
    Description

    Project

    All incurred costs will be charged to the tenant of the project owner

    Tenant

    Incurred costs will be charged to the tenant of the user owning the project resource (ie, data, analysis). The only exceptions are base tables and queries, as well as bench compute and storage costs, which are always billed to the project owner.

    For example, with billing mode set to Tenant, if tenant A has created a project resource and uses it in their project, then tenant A will pay for the resource data, compute costs and storage costs of any output they generate within the project. When they share the project with tenant B, then tenant B will pay the compute and storage for the data which they generate in that project. Put simply, in billing mode tenant, the person who generates data pays for the processing and storage of that data, regardless of who owns the actual project.

    If the project billing mode is updated after the project has been created, the updated billing mode will only be applied to resources generated after the change.

    If you are using your own S3 storage, then the billing mode impacts where collaborator data is stored.

    • Project billing will result in using your S3 storage for the data.

    • Tenant billing will result in collaborator data being stored in Illumina-managed storage instead of your own S3 storage.

    • Tenant billing, when your collaborators also have their own S3 storage and have it set as default, will result in their data being stored in their S3 storage.

    Use the Create OAuth access token button to generate an OAuth access token which is valid for 12 hours after generation. This token can be used by Snowflake and Tableau to access the data in your Base databases and tables for this Project.

    See SnowSQL for more information.

    Adding Linked Bundle Assets

    bundles

    Details List

    Billing Mode

    workspaces always use project billing even when tenant billing is selected on their project.

    Authentication Token

    Metadata

  • Administrative data.

  • This type will load the content of specific files from this project into a table. When adding or editing this schedule you can define the following parameters:

    • Name (required): The name of the scheduled job

    • Description: Extra information about the schedule

    • File name pattern (required): Define in this field a part or the full name of the file name or of the tag that the files you want to upload contain. For example, if you want to import files named sample1_reads.txt, sample2_reads.txt, … you can fill in _reads.txt in this field to have all files that contain _reads.txt imported to the table.

    • Generated by Pipelines: Only files generated by these selected pipelines are taken into account. When left clear, files from all pipelines are used.

    • Target Base Table (required): The table to which the information needs to be added. A drop-down list with all created tables is shown. This means the table needs to be created before the schedule can be created.

    • Write preference (required): Define data handling; whether it can overwrite the data

    • Data format (required): Select the data format of the files (CSV, TSV, JSON)

    • Delimiter (required): to indicate which delimiter is used in the delimiter separated file. If the delimiter is not present in list, it can be indicated as custom.

    • Active: The job will run automatically if checked

    • Custom delimiter: the custom delimiter that is used in the file. You can only enter a delimiter here if custom delimiter is selected.

    • Header rows to skip: The number of consecutive header rows (at the top of the table) to skip.

    • References: Choose which references must be added to the table

    • Advanced Options

      • Encoding (required): Select the encoding of the file.

      • Null Marker: Specifies a string that represents a null value in a CSV/TSV file.

    This type will create two new tables: BB_PROJECT_PIPELINE_EXECUTIONS_DETAIL and ICA_PROJECT_SAMPLE_META_DATA. The job will load metadata (added to the samples) into ICA_PROJECT_SAMPLE_META_DATA. The process gathers the metadata from the samples via the data linked to the project and the metadata from the analyses in this project. Furthermore, the schedular will add provenance data to BB_PROJECT_PIPELINE_EXECUTIONS_DETAIL. This process gathers the execution details of all the analyses in the project: the pipeline name and status, the user reference, the input files (with identifiers), and the settings selected at runtime. This enables you to track the lineage of your data and to identify any potential sources of errors or biases. So, for example, the following query will count how many times each of the pipelines was executed and sort it accordingly:

    To obtained the similar table for the failed runs, you can execute the following SQL query:

    When adding or editing this schedule you can define the following parameters:

    • Name (required): the name of this scheduled job.

    • Description: Extra information about the schedule.

    • Include sensitive meta data fields: in the meta data fields configuration, fields can be set to sensitive. When checked, those fields will also be added.

    • Active: the job will run automatically if ticked.

    • Source (Tenant Administrators Only):

      • Project (default): All administrative data from this project will be added.

      • Account: All administrative data from every project in the account will be added. When a tenant admin creates the tenant-wide table with administrative data in a project and invites other users to this project, these users will see this table as well.

    This type will automatically create a table and load administrative data into this table. A usage overview of all executions is considered administrative data.

    When adding or editing this schedule the following parameters can be defined:

    • Name (required): The name of this scheduled job.

    • Description: Extra information about the schedule.

    • Include sensitive metadata fields: In the metadata fields configuration, fields can be set to sensitive. When checked, those fields will also be added.

    • Active: The job will run automatically if checked.

    • Source (Tenant Administrators Only):

      • Project (default): All administrative data from this project will be added.

      • Account: All administrative data from every project in the account will be added. When a tenant admin creates the tenant-wide table with administrative data in a project and invites other users to this project, these users will see this table as well.

    Schedules can be deleted. Once deleted, they will no longer run, and they will not be shown in the list of schedules.

    When clicking the Run button, or Save & Run when editing, the schedule will start the job of importing the configured data in the correct tables. This way the schedule can be run manually. The result of the job can be seen in the tables. The load status is empty while the data is being processed and set to failed or succeeded once loading completes.

    Configure a schedule

    SELECT PIPELINE_NAME, COUNT(*) AS Appearances
    FROM BB_PROJECT_PIPELINE_EXECUTIONS_DETAIL
    GROUP BY PIPELINE_NAME
    ORDER BY Appearances DESC;
    SELECT PIPELINE_NAME, COUNT(*) AS Appearances
    FROM BB_PROJECT_PIPELINE_EXECUTIONS_DETAIL
    WHERE PIPELINE_STATUS = 'Failed'
    GROUP BY PIPELINE_NAME
    ORDER BY Appearances DESC;

    Files

    Metadata

    Administrative data

    Delete schedule

    Run schedule

    Bundles are packages of assets such as sample data, pipelines, tools and templates which you can use as a curated data set. Bundles can be provided both by Illumina and other providers, and you can even create your own bundles. You will find the Illumina-provided pipelines in bundles.
  • Audit/Event Logs are used for audit purposes and issue resolving.

  • System Settings contain general information susch as the location of storage space, docker images and tool repositories.

  • Projects are the main dividers in Platform Core. They provide an access-controlled boundary for organizing and sharing resources created in the platform. The Projects view is used to manage projects within the current tenant.

    To create a new project, click the Projects > + Create button.

    On the project creation screen, add information to create a project. See Project Details page for information about each field.

    Required fields include:

    • Name

      • 1-255 characters

      • Must begin with a letter

      • Characters are limited to alphanumerics, hyphens, underscores, and spaces

    • Project Owner Owner (and usually contact person) of the project. The project owner has the same rights as a project administrator, but can not be removed from a project without first assigning another project owner. This can be done by the current project owner, the tenant administrator or a project administrator of the current project. Reassignment is done at Projects > your_project > Project Settings > Team > Edit.

    • Region Select your project location. Options available are based on Entitlement(s) associated with purchased subscription.

    • Analysis Priority (Low/Medium(default)/High) This is balanced per tenant with high priority analyses started first and the system progressing to the next lower priority once all higher priority analyses are running. Balance your priorities so that lower priority projects do not remain waiting for resources indefinitely.

    • Billing Mode This determine who pays for the project costs (compute and storage) When set to project, the tenant of the project owner will be charged for compute and storage. When set to tenant, the tenant of the user who started the analysis will be charged for compute and storage.

    • Data Sharing Enable this if you want to allow the data from this project to be linked, moved or copied and used in other projects of your tenant. Disabling this is a convenient way to prevent your data from showing up in the list of available data to be linked, moved or copied in other projects. Even though this prevents copying and linking files and folders, it does not protect against someone downloading the files or copying the contents of your files from the viewer.

    • Storage Bundle This is auto-selected and appears when you select the Project Region.

    Click the Save button to finish creating the project. The project will be visible from the Projects view.

    Refer to the Storage Configuration documentation for details on creating a storage configuration.

    During project creation, select the I want to manage my own storage checkbox to use a Storage Configuration as the data provider for the project.

    With a storage configuration set, a project will have a 2-way sync with the external cloud storage provider: any data added directly to the external storage will be synchronized into the Platform Core project data, and any data added to the project will be synchronized into the external cloud storage.

    If there is an issue with your storage configuration, it will be indicated on the project tile.

    Several tools are available to assist you with keeping an overview of your projects. These filters work in both list and tile view and persist across sessions.

    1. Searching is a case-insensitive wildcard filter. Any project which contains the characters will be shown. Use * as wildcard in searches. Be aware that operators without search words are blocked and will result in Unexpected error occurred when searching for projects. You can use the brackets, AND, OR and NOT operators, provided that you do not start the search with them (Monkey AND Banana is allowed, AND Aardvark by itself is invalid syntax)

    2. Filter by Workgroup : Projects in Platform Core can be accessible for different workgroups. This drop-down list allows you to filter projects for specific workgroups. To reset the filter so it displays projects from all your workgroups, use the x on the right which appears when a workgroup is selected.

    3. Hidden projects : You can hide projects (Projects > your_project > Project settings > Details > Hide) which you no longer use. Hiding will delete data in base and bench and will thus be irreversible.

      • You can still see hidden projects if you select this option and delete the data they contain at Projects > your_project > Data to save on storage costs.

      • If you are using your own S3 bucket, your S3 storage will be unlinked from the project, but the data will remain in your S3 storage. Your S3 storage can then be used for other projects.

      • Hiding projects is not possible for projects.

    1. Favorites : By clicking on the star next to the project name in the tile view, you set a project as favorite. You can have multiple favorites and use the Favorites checkbox to only show those favorites. This prevents having too many projects visible.

    2. Tile view shows a grid of projects. This view is best suited if you only have a few projects or have filtered them out by creating favorites. A single click will open the project.

    3. List view shows a list of projects. This view allows you to add additional filters on name, description, location, user role, tenant, size and analyses. Click on the project name to open it.

    In tile view, your project tiles will show the project name, location, tenant, size, number of analyses and your role.

    project tile view

    In list view, the star indicates your favourites while warnings, errors and information icons are displayed next to the project name. Hover over those icons to see the details.

    Illumina software applications which do their own data management on Platform Core (such as BSSH) store their resources and data in a project in the same was as manually created projects work in Platform Core. For Platform Core, these projects are considered externally-managed projects and there are a number of restrictions on which actions are allowed on externally-managed projects from within Platform Core. For example, you can not delete or move externally-managed data. This is to prevent inconsistencies when these applications want to access their own project data.

    • You can add files and data such as samples to externally managed projects. Separation of data is ensured by only allowing additional files at the root level or in dedicated subfolders which you can create in your projects. Data which you have added can be moved and deleted again.

    • You can add bundles to externally managed projects, provided those bundles do not come with additional restrictions for the project.

    • You can start workspaces in externally-managed projects. The resulting data will be stored in the externally-managed project.

    • Project administrators and tenant administrators can disable on externally managed projects at Projects > externally_managed_project > Project Settings > Details to prevent data from being copied or extracted.

    Projects are indicated as externally-managed in the projects overview screen by a project card with a managed by app <app name> label.

    You can keep track of which files are externally controlled and which are Platform Core-managed by means of the “managed by” column, visible in the data list view of externally-managed projects at Projects > your_project > Data.

    If you have an externally-manage project and want to move the data to another project, you need to:

    1. Copy the data from the externally-managed project to the other (new) project.

    2. From within your external application, delete the data which is stored in the externally-managed project in Platform Core.

    Externally-managed projects protect their notification subscriptions to ensure no user can delete them. It is possible to add your own subscriptions to externally-managed projects, see notifications for more information.

    For a better understanding of how all components of Platform Core work, try the end-to-end tutorial.

    You can share links to your project and content within projects to people who have access to it. Sharing is done by copying the URL from your browser. This URL contains both the filters and the sort options which you have applied.

    Introduction

    There is a combined limit of 30,000 projects and bundles per tenant.

    Create new Project

    You may see projects with an additional Information field, this is for backwards compatibility as the field has been superseded by the Short description field.

    Create with Storage Configuration

    Managing Projects

    Items which are shown in list view have an Export option at the bottom of the screen. You can choose to support the entire page or only the selected rows in CSV, JSON or Excel format.

    If you are missing Projects

    If you are missing projects, especially those been created by other users, the workgroup filter might still be active. Clear the filter with the x to the right. You can verify the list of projects to which you have access with the icav2 projects list.

    Externally-managed projects

    Tertiary modules such as are not supported for externally-managed projects.

    Data Transfer

    Notes

    When you create a folder with a name which already exists as externally-managed folder, your project will have that folder twice. Once Platform Core-managed and once externally-managed.

    Tutorial

    Sharing

    Create a new project using the +Create button.
  • Give your project a name and region and click Save.

  • Navigate to the Platform Core Cohorts module by selecting Projects > your_project > Cohorts > Cohorts.

    1. Navigate to Projects > your_project > Cohorts > Cohorts.

    2. Click Create Cohort button.

    3. Enter a name for your cohort, for example "Rare Disease + 1kGP" at the top, left of the pencil icon.

    4. From the Public Data Sets list select:

      • DRAGEN-1kGP

      • All Rare genetic disease cohorts

    1. Under Selected Conditions in right panel, click on Apply

    2. A new page opens with your cohort in a top-level tab.

    3. Expand Query Details to see the study makeup of your cohort.

    4. A set of 4 Charts will be open by default. If they are not, click Show Charts.

      • Use the gear icon in the top-right of the Charts pane to change chart settings.

    5. The bottom section is demarcated by 8 tabs (Subjects, Marker Frequency, Genes, GWAS, PheWAS, Correlation, Molecular Breakdown, CNV).

    6. The Subjects tab displays a list of exportable Subject IDs and attributes.

      • Clicking on a Subject ID link opens up a Subject details page.

    1. A recent GWAS publication identified 10 risk genes for intellectual disability (ID) and autism. Our task is to evaluate them in Platform Core Cohorts: TTN, PKHD1, ANKRD11, ARID1B, ASXL3, SCN2A, FHL1, KMT2A, DDX3X, SYNGAP1.

    2. First we Hide charts for more visual space.

    3. Click the Genes tab where you need to query a gene to see and interact with results.

    4. Type SCN2A into the Gene search field and select it from autocomplete dropdown options.

    5. The Gene Summary tab now lists information and links to public resources about SCN2A.

    6. Click on the Variants tab to see an interactive Legend and analysis tracks.

      • The Needle Plot displays gnomAD Allele Frequency for variants in your cohort. Some are in SCN2A conserved protein domains.

      • In Legend, switch the Plot by option to Sample Count in your cohort.

    7. The Primate AI track displays Scores for potential missense variants, based on polymorphisms observed in primate species. Points above the dashed line for the 75th percentile may be considered "likely pathogenic" as cross-species sequence is highly conserved; you often see high conservancy at the functional domains. Points below the 25th percentile may be considered "likely benign".

    8. The Pathogenic variants track displays markers from ClinVar color-coded by variant type. Hover over them to see pop-ups with more information.

    9. The Exons track shows mRNA exon boundaries with click and zoom functionality at the ends.

    10. Below the Needle Plot and analysis tracks is a list of Variants observed in the selected cohort.

      • The Export Gene Variants table icon is above the legend on right side.

    11. Click on the Gene Expression tab to see a Bar chart of 50 normal tissues from GTEx in transcripts per million (TPM). SCN2A is highly expressed in certain brain tissues, indicating specificity to where good markers for intellectual disability and autism could be expected.

    12. As a final exercise in discovering good markers, click on the tab for Genetic Burden Test. The table here associates Phenotypes with Mutations Observed in each Study selected for our cohort, alongside Mutations Expected to derive p-values. Given all considerations above, SCN2A is good marker for intellectual disability (p < 1.465 x 10 -22) and autism (p < 5.290 x 10 -9).

    13. Continue to check the other genes of interest in step 1.

    Cohorts Walk-through: Rare Genetic Disorders

    Login and Create a new Platform Core Project

    Create and Review a Rare Disease Cohort

    A cohort can also be created based on Technology, Disease Type and Tissue.

    Analyze Your Rare Disease Cohort Data

    DRAGEN by CLI
    Cohort Analysis
    Compare Cohorts
    Cohorts Data in Platform Core Base

    Connect AWS S3 Bucket

    You can use your own S3 bucket (unversioned, versioned, versioning-suspended) with Illumina BioInsight Platform Core for data storage. This section describes how to configure your AWS account to allow Platform Core to connect to an S3 bucket.

    Prerequisite

    AWS CLI

    These instructions utilize the AWS CLI. Follow the AWS CLI documentation for instructions to download and install.

    Best Practices

    Do not use the root folder of your S3 storage

    When configuring a new project in Platform Core to use a preconfigured S3 bucket, create a folder on your S3 bucket in the AWS console. This folder will be connected to Platform Core as a prefix.

    Failure to create a folder will result in the root folder of your S3 bucket being assigned which will block your S3 bucket from being used for other Platform Core projects with the error "Conflict while updating file/folder. Please try again later."

    Service Control Policies & Resource Control Policies

    When configuring cross-account access for Bring Your Own Bucket (BYOB), organisational policy layers Service Control Policies (SCPs) and Resource Control Policies (RCPs) can prevent access even when the bucket policy is valid.

    For cross-account S3 requests, AWS evaluates permissions in the following order:

    1. Source Account Service Control Policies determine which actions the principal is allowed to perform, regardless of the destination resource.

    2. Destination Account Resource Control Policies determine what external principals can do on resources within that account and act as a control layer above the bucket policy.

    3. Bucket Policy and Identity-Based Policies are evaluated only after both SCP and RCP checks pass. This means that an explicit Deny, or the absence of a required Allow, in either the SCP or RCP results in an immediate final denial and the bucket policy is not evaluated.

    You can use either or for setting the permissions with IAM Role offering better security for connecting to your own S3 storage.

    uses long-term credentials to connect external systems to your S3 storage. These credentials (access_key_id and secret_access_key) have to be kept secure and should be regularly rotated, which requires updating the keys in all systems that use these keys.

    do not use long-term credentials. Instead temporary (12 hours) security permissions are provided when external systems assume the role. A permission policy determines which actions are allowed and a trust policy determines who (which software) can assume the role. When Platform Core requests to assume the role, the trust policy is checked to see if Platform Core is allowed to assume the role and if allowed, short-lived credentials are provided so Platform Core can borrow the permissions for that role.

    You can enable SSE using an Amazon S3-managed key (SSE-S3). Instructions for using KMS-managed (SSE-KMS) keys are found .

    The AWS S3 bucket must exist in the same AWS region as the Platform Core project. See the table below for a mapping of Platform Core project regions to AWS regions:

    Platform Core Project Region
    AWS Region

    (*) BSSH is not currently deployed on the South Korea instance, resulting in limited functionality in this region with regard to sequencer integration.

    You can use unversioned (only one copy of an object exists), versioned (writing creates new versions) and suspended (versioning paused) buckets as own S3 storage.

    If you connect buckets with object versioning, the data in Platform Core will be automatically synced with the data in object store. When an object is deleted without specifying a particular version, a Delete marker is created on the objectstore to indicate that the object has been deleted. Platform Core will reflect the object state by deleting the record from the database. No further action on your side is needed to sync.

    Public Data Sets

    Platform Core Cohorts comes front-loaded with a variety of publicly accessible data sets, covering multiple disease areas and also including healthy individuals.

    Data set
    Samples
    Diseases/Phenotypes
    Reference

    1kGP-DRAGEN

    3202 WGS: 2504 original samples plus 698 relateds

    Service Connector Troubleshooting

    This topic contains common service connector issues and possible causes.

    General

    General issues
    Solution

    Connector is connected, but uploads won’t start

    To troubleshoot, create a new empty folder on your local disk, add a small file, and configure this folder as upload folder.

    • If this works, and your sample files are on a shared drive, consult the section.

    • If this works, and your sample files are on a local disk, there are several possible causes:

    Upload from shared drive does not work

    Follow the guidelines in section. Inspect the connector BSC.log file for any error messages related to the folder not being found.

    • If there is a related message, possible causes are:

      • An issue with the folder name, such as special characters or spaces. As best practice, use only alphanumeric characters, underscores, dashes and periods.

    Issue
    Solution
    Issue
    Solution
    Issue
    Solution

    Project Connector

    The platform GUI provides the Project Connector which allows data to be linked automatically between projects. This creates a one-way dynamic link for files and samples from source to destination, meaning that additions and deletions of data in the source project also affect the destination project. This differs from copying or moving which create editable copies of the data.

    • Copy creates a copy of the file or folder. The data is decoupled and can be edited and deleted.

    • Move deletes the data on the source destination and moves it to target destination from where it can be edited and deleted. Once deleted, the information ins lost.

    • Manual linking creates a snapshot link to files and folder from the source destination. Changes to those files at the source are not propagated after they have been linked. You can not delete the data, but you can unlink it. to remove it from your destination project.

    • Project Connectors creates a dynamic link to the source project. All data which already exists in the source project before the project connector is created, is ignored. All new data which is added once the project connector is created, is automatically propagated to the destination project. Because this is a dynamic link, changes to the new data are also propagated. If there is data propagated which you do not need in the destination project, you can unlink it from there.

    one-way
    files
    folders
    erases source data
    propagate source edits
    editable on destination
    1. Select the source project (project containing the original data which will be linked to the target project) from the Projects page (Projects > your_source_project).

    2. Select Project Settings > Details.

    3. Select Edit

    1. Select the destination project (the project to which data from the source project will be linked) from the Projects page (Projects > your_destination_project).

    2. From the projects menu, select Project Settings > Connectivity > Project Connector

    3. Select + Create and complete the necessary fields.

    The examples below will restrict linking Files based on the Format field.

    • Only Files with Format of FASTQ will be linked:

      [?($.details.format.code == 'FASTQ')]

    • Only Files with Format of VCF will be linked:

      [?($.details.format.code == 'VCF')]

    The examples below will restrict linked Files based on a filenames.

    • Exact match to 'Sample-1_S1_L001_R1_001.fastq.gz':

      [?($.details.name == 'Sample-1_S1_L001_R1_001.fastq.gz')]

    • Ends with '.fastq.gz':

      [?($.details.name =~ /.*\.fastq.gz/)]

    The examples below will restrict linking Samples based on User Tags and Sample name, respectively.

    • Only Samples with the User Tag 'WGS-Project-1'

      [?('WGS-Project-1' in $.tags.userTags)]

    • Link a Sample with the name 'BSSH_Sample_1':

      [?($.name == 'BSSH_Sample_1')]

    CWL DRAGEN Pipeline

    In this tutorial, we will demonstrate how to create and launch a DRAGEN pipeline using the CWL language.

    In Platform Core, CWL pipelines are built using tools developed in CWL. For this tutorial, we will use the "DRAGEN Demo Tool" included with DRAGEN Demo Bundle 3.9.5.

    Linking bundle to Project

    1. Start by selecting a project at the Projects inventory.

    1. In the details page, select Edit.

    1. In the edit mode of the details page, click the + button in the LINKED BUNDLES section.

    1. In the Add Bundle to Project window: Select the DRAGEN demo tool bundle from the list. Once you have selected the bundle, the Link Bundles button becomes available. Select it to continue.

    1. In the project details page, the selected bundle will appear under the LINKED BUNDLES section. If you need to remove a bundle, click on the - button. Click Save to save the project with linked bundles.

    1. From the project details page, select Pipelines > CWL

    1. You will be given options to create pipelines using a graphical interface or code. For this tutorial, we will select Graphical.

    1. Once you have selected the Graphical option, you will see a page with multiple tabs. The first tab is the Information page where you enter pipeline information. You can find the details for different fields in the tab in the . The following three fields are required for the INFORMATION page.

      • Code: Provide pipeline name here.

      • Description: Provide pipeline description here.

    1. The Documentation tab provides options for configuring the HTML description for the tool. The description appears in the tool repository but is excluded from exported CWL definitions.

    2. The Definition tab is used to define the pipeline. When using graphical mode for the pipeline definition, the Definition tab provides options for configuring the pipeline using a visualization panel (A) and a list of component menus (B). You can find details on each section in the component menu

    1. To build a pipeline, start by selecting Machine PROFILE from the component menu section on the right. All fields are required and are pre-filled with default values. Change them as needed.

      • The profile Name field will be updated based on the selected Resource. You can change it as needed.

      • Color assigns the selected color to the tool in the design view to easily identify the machine profile when more than one tool is used in the pipeline.

    1. Once you have selected the Machine Profile for the tool, find your tool from the Tool Repository at the bottom section of the component menu on the right. In this case, we are using the DRAGEN Demo Tool. Drag and drop the tool from the Tool Repository section to the visualization panel.

    1. The dropped tool will show the machine profile color, number of outputs and inputs, and warning to indicate missing parameters, mandatory values, and connections. Selecting the tool in the visualization panel activates the tool (DRAGEN Demo Tool) component menu. On the component menu section, you will find the details of the tool under Tool - DRAGEN Demo Tool. This section lists the inputs, outputs, additional parameters, and the machine profile required for the tool. In this case, the DRAGEN Demo Tool requires three inputs (FASTQ read 1, FASTQ read 2, and a Reference genome). The tool has two outputs (a VCF file and an output folder). The tool also has a mandatory parameter (Output File Prefix). Enter the value for the input parameter (Output File Prefix) in the text box.

    1. The top right corner of the visualization panel has icons to zoom in and out in the visualization panel followed by three icons: ref, in, and out. Based on the type of input/output needed, drag and drop the icons into the visualization area. In this case, we need three inputs (read 1, read 2, and Reference hash table.) and two outputs (VCF file and output folder). Start by dragging and dropping the first input (a). Connect the input to the tool by clicking on the blue dot at the bottom of the input icon and dragging it to the blue dot representing the first input on the tool (b). Select the input icon to activate the input component menu. The input section for the first input lets you enter the Name, Format, and other relevant information based on tool requirements. In this case, for the first input, enter the following information:

      • Name: FASTQ read 1

    1. Repeat the step for other inputs. Note that the Reference hash table is treated as the input for the tool rather than Reference files. So, use the input icon instead of the reference icon.

    2. Repeat the process for two outputs by dragging and connecting them to the tool. Note that when connecting output to the tool, you will need to click on the blue dot at the bottom of the tool and drag it to the output.

    1. Select the tool and enter additional parameters. In this case, the tool requires Output File Prefix. Enter demo_ in the text box.

    2. Click on the Save button to save the pipeline. Once saved, you can run it from the Pipelines page under Flow from the left menus as any other pipeline.

    Containers in Bench

    Bench has the ability to handle containers inside a running workspace. This allows you to install and package software more easily as a container image and provides capabilities to pull and run containers inside a workspace.

    Bench offers a container runtime as a service in your running workspace. This allows you to do standardized container operations such as pulling in images from public and private registries, build containers at runtime from a Dockerfile, run containers and eventually publish your container to a registry of choice to be used in different Platform Core products such as Platform Core Flow.

    Setup

    The Container Service is accessible from your Bench workspace environment by default.

    The container service uses the workspace disk to store any container images you pulled in or created.

    To interact with the Container Service, a container remote client CLI is exposed automatically in the /data/.local/bin folder. The Bench workspace environment is preconfigured to automatically detect where the Container Service is made available using environment variables. These environment variables are automatically injected into your environment and are not determined by the Bench Workspace Image.

    Use either docker or podman cli to interact with the Container Service. Both are interchangeable and support all the standardized operations commonly known.

    To run a container, the first step is to either build a container from a source container or pull in a container from a registry.

    A public image registry does not require any form of authentication to pull the container layers.

    The following command line example shows how to pull in a commonly known image.

    To pull images from a private registry, the Container Service needs to authenticate to the Private Registry.

    The following command line example shows how to instruct the Container Service to login into the Private registry.hub.docker.com registry

    Depending on the Registry setup you can publish Container Images with or without authentication. If Authentication is required, follow the login procedure described in

    The following command line example shows how to publish a locally available Container Image to a private registry in Dockerhub.

    The following example shows how to save a locally available Container Image as a compressed tar archive.

    This lets you upload the into the Private Platform Core Docker Registry.

    The following example shows how to list all locally available Container Images

    Container Images require storage capacity on the Bench Workspace disk. The capacity is shown when listing the locally available container images. The container Images are persisted on disk and remain available whenever a workspace stops and restarts.

    The following example shows how to clean up a locally available Container Image:

    A Container Image can be instantiated in a Container running inside a Bench Workspace.

    By default the workspace disk (/data) will be made available inside the running Container. This lets you to access data from the workspace environment.

    When running a Container, the default user defined in the Container Image manifest will be used and mapped to the uid and the gid of the user in the running Bench Workspace (uid:1000, gid: 100). This will ensure files created inside the running container on the workspace disk will have the same file ownership permissions.

    The following command line example shows how to run an instance a locally available Container Image as a normal user:

    Running a Container as root user maps the uid and gid inside the running Container to the running non-root user in the Bench Workspace. This lets you act as user with uid 0 and gid 0 inside the context of the container.

    By enabling this functionality, you can install system level packages inside the context of the Container. This can be leveraged to run tools that require additional system level packages at runtime.

    The following command line example shows how to run an instance of a locally available Container as root user and install system level packages.

    When no specific mapping is defined using the --userns flag, the user in the running Container user will be mapped to an undefined uid and gid based on an offset of id 100000. Files created in your workspace disk from the running Container will also use this uid and gid to define the ownership of the file.

    Building a Container

    To build a Container Image, you need to describe the instructions in a Dockerfile.

    This next example builds a local Container Image and tags it as myimage:1.0 The Dockerfile used in this example is

    The following command line example will build the actual Container Image.

    Tips and Tricks

    Developing on the cloud incurs inherent runtime costs due to compute and storage used to execute workflows. Here are a few tips that can facilitate development:

    • Leverage the cross-platform nature of these workflow languages. Both CWL and Nextflow can be run locally in addition to on Platform Core. When possible, testing should be performed locally before attempting to run in the cloud. For Nextflow, configuration files can be utilized to specify settings to be used either locally or on Platform Core. An example of advanced usage of a config would be applying the scratch directive to a set of process names (or labels) so that they use the higher performance local scratch storage attached to an instance instead of the shared network disk,

      withName: 'process1|process2|process3' { scratch = '/scratch/' }
      withName: 'process3' { stageInMode = 'copy' } // Copy the input files to scratch instead of symlinking to shared network disk
    • When trying to test on the cloud, it's oftentimes beneficial to create scripts to automate the deployment and launching / monitoring process. This can be performed either using the or by creating your own scripts integrating with the REST API.

    • For scenarios in which instances are terminated prematurely (for example, while using spot instances) without warning, you can implement scripts like the following to retry the job a certain number of times. Adding the following script to 'nextflow.config' enables five retries for each job, with increasing delays between each try.

      Note: Adding the retry script where it is not needed might introduce additional delays.

    • When hardening a Nextflow to handle resource shortages (for example exit code 2147483647), an immediate retry will in most circumstances fail because the resources have not yet been made available. It is best practice to use which has an increasing backoff delay, allowing the system time to provide the necessary resources.

    • When publishing your Nextflow pipeline, make sure your have defined a container such as 'public.ecr.aws/lts/ubuntu:22.04' and are not using the default container 'ubuntu:latest'.

    • To limit potential costs, there is a timeout of 96 hours: if the analysis does not complete within four days, it will go to a 'Failed' state. This time begins to count as soon as the input data is being downloaded. This takes place during the Platform Core 'Requested' step of the analysis, before going to 'In Progress'. In case parallel tasks are executed, running time is counted once. As an example, let's assume the initial period before being picked up for execution is 10 minutes and consists of the request, queueing and initializing. Then, the data download takes 20 minutes. Next, a task runs on a single node for 25 minutes, followed by 10 minutes of queue time. Finally, three tasks execute simultaneously, each of them taking 25, 28, and 30 minutes, respectively. Upon completion, this is followed by uploading the outputs for one minute. The overall analysis time is then 20 + 25 + 10 + 30 (as the longest task out of three) + 1 = 86 minutes:

    If there are no available resources or your project priority is low, the time before download commences will be substantially longer.

    • By default, Nextflow will not generate the trace report. If you want to enable generating the report, add the section below to your userNextflow.config file.

    1. Useful Links

    CWL

    Platform Core supports running pipelines defined using Common Workflow Language (CWL).

    Compute Type

    To specify a compute type for a CWL CommandLineTool, either define the ram and number of cores or use the resource type and size. The Platform Core compute type will automatically be determined based on CWL ResourceRequirement coresMin/coresMax (CPU) and ramMin/ramMax (Memory) values using a "best fit" strategy to meet the minimum specified requirements (See the Compute Types table to see to what the resources are mapped).

    For example, take the following ResourceRequirements:

    requirements:
        ResourceRequirement:
          ramMin: 10240
          coresMin: 6

    This will result in a best fit of standard-large Platform Core compute type request for the task.

    If the specified requirements can not be met by any of the presets, the task will be rejected and failed.

    See the example below to use the ResourceRequirement in the cwl workflow with the Predefined

    For each compute type, you can choose between the

    • Standard - (Default) or

    • Economy - tiers.

    You can set economy mode with the "tier" parameter

    If no Docker image is specified, Ubuntu will be used as default. Both : and / can be used as separator.

    Platform Core supports overriding workflow requirements at load time using Command Line Interface (CLI) with JSON input. Please refer to for more details on the CWL overrides feature.

    In Platform Core you can provide the "override" recipes as a part of the input JSON. The following example uses CWL overrides to change the environment variable requirement at load time.

    JSON Scatter Gather Pipeline

    Let's create the with a JSON input form.

    Select Projects > your_project > Flow > Pipelines. From the Pipelines view, click the +Create > Nextflow > JSON based button to start creating a Nextflow pipeline.

    In the Details tab, add values for the required Code (unique pipeline name) and Description fields. Nextflow Version and Storage size defaults to preassigned values.

    First, we present the individual processes. Select Nextflow files > + Create and label the file split.nf. Copy and paste the following definition.

    Next, select +Create and name the file sort.nf

    Bench Clusters

    Workspaces can have their own dedicated cluster which consists of a number of nodes. First the workspace node, which is used for interacting with the cluster, is started. Once the workspace node is started, the workspace cluster can be started.

    The cluster consists of 2 components

    • The manager node which orchestrates the workload across the members.

    • Anywhere between 0 and up to maximum 50 member nodes.

    CWL Graphical Pipeline

    This tutorial aims to guide you through the process of creating CWL tools and pipelines from the very beginning. By following the steps and techniques presented here, you will gain the necessary knowledge and skills to develop your own pipelines or transition existing ones to Platform Core.

    The foundation for every tool in Platform Core is a Docker image (externally published or created by the user). Here we present how to create your own Docker image for the popular tool (FASTQC).

    Copy the contents displayed below to a text editor and save it as a Dockerfile. Make sure you use an editor which does not add formatting to the file.

    Open a terminal window, place this file in a dedicated folder and navigate to this folder location. Then use the following command:

    Check the image has been successfully built:

    Check that the container is functional:

    Once inside the container check that the

    Quote: The value (single character) that is used to quote data sections in a CSV/TSV file. When this character is encountered at the beginning and end of a field, it will be removed. For example, entering " as quote will remove the quotes from "bunny" and only store the word bunny itself.
  • Ignore unknown values: This applies to CSV-formatted files. You can use this function to handle optional fields without separators, provided that the missing fields are located at the end of the row. Otherwise, the parser can not detect the missing separator and will shift fields to the left, resulting in errors.

    • If headers are used: The columns that have matching fields are loaded, those that have no matching fields are loaded with NULL and remaining fields are discarded.

    • If no headers are used: The fields are loaded in order of occurrence and trailing missing fields are loaded with NULL, trailing additional fields are discarded.

  • In Legend, uncheck all Variant Types except Stop gained. Now you should see 7 variants.

  • Hover over pin heads to see pop-up information about particular variants.

  • validationWarnings

    A list of RenderMessages representing validation warnings. A user may choose to ignore these validation warnings and start the pipeline execution request.

    storageSize

    The suitable value for storageSize. Must be one of the options of input.storageSizeOptions. When absent or null, it is ignored.

    validation errors and validation warnings can use 'storageSize' as fieldId to let an error appear on the storage size field. 'storageSize' is the value of the changedFieldId when the user alters the chosen storage size.

    Presumed healthy

    DRAGEN reanalysis of the 1000 Genomes Dataset

    DDD

    4293 (3664 affected), de novos only

    Developmental disorders

    McRae et al., Nature 19:1194-1196

    EPI4K

    356, de novos only

    Epilepsy

    Epi4K Consortium, Nature 501:217-221

    ASD Cohorts

    6786 (4266 affected), de novos only

    Autism Spectrum disorder

    Iossifov et al. Neuron 74:285-299; Iossifov et al. Nature 498:216-221; O'Roak et al. Nature 485:246-250; Sanders et al. Nature 485:237-241; Sanders et al. Neuron 87:1215-1233; De Rubeis et al. Nature 515:209-215

    De Ligt et al.

    100, de novos only

    Intellectual disability

    De Ligt et al., N Engl J Med 367:1921-1929

    Homsy et al.

    1213, de novos only

    Congenital heart disease (HP:0030680)

    Homsy et al., Science 350:1262-1266

    Lelieveld et al.

    820, de novos only

    Intellectual disability

    Lelieveld et al., Nature Neuroscience19:1194-1196

    Rauch et al.

    51, de novos only

    Intellectual disability

    Rauch et al., Lancet 380:1674-1682

    Rare Genomes Project

    315 WES (112 pedigrees)

    Various

    https://raregenomes.org/

    TCGA

    ca. 4200 WES, ca. 4000 RNAseq

    12 tumor types

    https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga

    GEO

    RNAseq

    Auto-immune disorders, incl. asthma, arthritis, SLE, MS, Crohn's disease, Psoriasis, Sjögren's Syndrome

    For GEO/GSE study identifiers, please refer to the in-product list of studies

    RNAseq

    Kidney diseases

    For GEO/GSE study identifiers, please refer to the in-product list of studies

    RNAseq

    Central nervous system diseases

    For GEO/GSE study identifiers, please refer to the in-product list of studies

    RNAseq

    Parkinson's disease

    For GEO/GSE study identifiers, please refer to the in-product list of studies

    Uploading Data

    API Bench Analysis

    Use non-indexed folders as normal folders for Analysis runs and bench. Different methods are available with the API such as creating temporary credentials to upload data to S3 or using /api/projects/{projectId}/data:createFileWithUploadUrl

    Downloading Data

    Yes

    Use non-indexed folders as normal folders for Analysis runs and bench. Use temporary credentials to list and download data with the API.

    Analysis Input/Output

    Yes

    Non-indexed files can be used as input for an analysis and the non-indexed folder can be used as output location. You will not be able to view the contents of the input and output in the analysis details screen.

    Bench

    Yes

    Non-indexed folders can be used in Bench and the output from Bench can be written to non-indexed folders. Non-indexed folders are accessible across Bench workspaces within a project.

    Viewing

    No

    The folder is a single object, you can not view the contents.

    Linking

    Yes

    You cannot see non-indexed folder contents.

    Copying

    No

    Prohibited to prevent storage issues.

    Moving

    No

    Prohibited to prevent storage issues.

    Managing tags

    No

    You cannot see non-indexed folder contents.

    Managing format

    No

    You cannot see non-indexed folder contents.

    Use as Reference Data

    No

    You cannot see non-indexed folder contents.

    endpoint

    Storage Configuration

    Storage configuration to use for data stored in the project

    User Tags

    User tags on the project

    Technical Tags

    Technical tags on the project

    Metadata Model

    Metadata model assigned to the project

    Project Location

    Project region where data is stored and pipelines are executed. Options are derived from the Entitlement(s) assigned to user account, based on the purchased subscription

    Storage Bundle

    Storage bundle assigned to the project. Derived from the selected Project Location based on the Entitlement in the purchased subscription

    Billing Mode

    Billing mode assigned to the project

    Data sharing

    Enables data and samples in the project to be linked to other projects

    Bench
    externally-managed
    bench
    data sharing
    CLI command
    cohorts

    Storage size: Select the storage size from the drop-down menu.

    Tier lets you select Standard or Economy tier for AWS instances. Standard is on-demand ec2 instance and Economy is spot ec2 instance. You can find the difference between the two AWS instances here. You can find the price difference between the two tiers here.

  • Resource lets you choose from various compute resources available. In this case, we are building a DRAGEN pipeline and we will need to select a resource with FPGA in it. Choose from FPGA resources (FPGA Medium/Large) based on your needs.

  • Format: FASTQ
  • Comments: any optional comments

  • You can select multiple bundles using Ctrl + Left mouse button or Shift + Left mouse button.

    Create Pipeline

    GitBook
    here
    Illumina BioInsight Platform Core
    Illumina BioInsight Platform Core: Cohorts Multi-Omic Cancer

    Container Management

    Pulling a Container Image

    Public Registry

    The Container Service uses Dockerhub by default to pull images from if no registry hostname is defined in the container image URI.

    Private Registry

    Depending on your authorisations in the private registry you will be able to pull and push images. These authorisations are managed outside of the scope of Platform Core.

    Pushing a Container Image

    Saving a Container Image as an Archive

    Listing Locally Available Container Images

    Deleting a Container Image

    When a Container Image has multiple tags, all the tags need to be removed individually to free up disk capacity.

    Running a Container

    Run a Container as a normal user

    Run a Container as root user

    When defining the build context location, keep in mind that using the HOME folder (/data) will index all files available in /data, which can be a lot and will slow down the process of building. Hence the reason to use a minimal build context whenever possible.

    Private Registry
    container image
    • FPGA requirements can not be set by means of CWL ResourceRequirements.

    • The Machine Profile Resource in the graphical editor will override whatever is set for requirements in the ResourceRequirement.

    Standard vs Economy

    Considerations

    CWL Overrides

    Compute Types
    AWS on-demand
    AWS spot instance
    CWL documentation
    . Copy and paste the following definition.

    Select +Create again and label the file merge.nf. Copy and paste the following definition.

    Edit the main.nf file by navigating to the Nextflow files > main.nf tab and copying and pasting the following definition.

    Here, the operators flatten and collect are used to transform the emitting channels. The Flatten operator transforms a channel in such a way that every item of type Collection or Array is flattened so that each single entry is emitted separately by the resulting channel. The collect operator collects all the items emitted by a channel to a List and return the resulting object as a sole emission.

    On the Inputform files tab, edit the inputForm.json to allow selection of a file.

    Click the Simulate button (at the bottom of the text editor) to preview the launch form fields.

    The onSubmit.js and onRender.js can remain with their default scripts and are just shown here for reference.

    Click the Save button to save the changes.

    Pay close attention to uppercase and lowercase characters when creating pipelines.

    Nextflow files

    split.nf

    sort.nf

    Nextflow Scatter Gather pipeline

    merge.nf

    main.nf

    Inputform files

    inputForm.json

    onSubmit.js

    onRender.js

    # Pull Container image from Dockerhub 
    /data $ docker pull alpine:latest  
    # Pull a Container Image from Dockerhub 
    /data $ docker login -u <username> registry.hub.docker.com 
    Password:  
    Login Succeeded! 
    /data $ docker pull registry.hub.docker.com/<privateContainerUri>:<tag> 
    # Push a Container Image to a Private registry in Dockerhub 
    /data $ docker pull alpine:latest 
    /data $ docker tag alpine:latest registry.hub.docker.com/<privateContainerUri>:<tag> 
    /data $ docker push registry.hub.docker.com/<privateContainerUri>:<tag> 
    # Save a Container Image as a compressed archive 
    /data $ docker pull alpine:latest 
    /data $ docker save alpine:latest | bzip2 > /data/alpine_latest.tar.bz2 
    # List all local available images 
    /data $ docker images 
    REPOSITORY                TAG         IMAGE ID      CREATED      SIZE 
    docker.io/library/alpine  latest      aded1e1a5b37  3 weeks ago  8.13 MB 
    # Remove a locally available image 
    /data $ docker rmi alpine:latest 
    # Run a Container as a normal user 
    /data $ docker run -it --rm alpine:latest 
    ~ $ id 
    uid=1000(ica) gid=100(users) groups=100(users)  
    # Run a Container as root user 
    /data $ docker run -it --rm --userns keep-id:uid=0,gid=0 --user 0:0 alpine:latest 
    / # id 
    uid=0(root) gid=0(root) groups=0(root) 
    / # apk add rsync 
    ... 
    / # rsync  
    rsync  version 3.4.0  protocol version 32 
    ... 
    # Run a Container as a non-mapped root user 
    /data $ docker run -it --rm --user 0:0 alpine:latest 
    / # id 
    uid=0(root) gid=0(root) groups=100(users),0(root) 
    / # touch /data/myfile 
    / #  
    # Exited the running Container back to the shell in the running Bench Workspace 
    /data $ ls -al /data/myfile  
    -rw-r--r-- 1 100000 100000 0 Mar 13 08:27 /data/myfile 
    FROM alpine:latest 
    RUN apk add rsync 
    COPY myfile /root/myfile 
    # Build a Container image locally 
    /data $ mkdir /tmp/buildContext 
    /data $ touch /tmp/buildContext/myFile 
    /data $ docker build -f /tmp/Dockerfile -t myimage:1.0 /tmp/buildContext 
    ... 
    /data $ docker images 
    REPOSITORY                TAG         IMAGE ID      CREATED             SIZE 
    docker.io/library/alpine  latest      aded1e1a5b37  3 weeks ago         8.13 MB 
    localhost/myimage         1.0         06ef92e7544f  About a minute ago  12.1 MB 
    requirements:
        ResourceRequirement:
            https://platform.illumina.com/rdf/ica/resources:type: fpga2
            https://platform.illumina.com/rdf/ica/resources:size: medium 
            https://platform.illumina.com/rdf/ica/resources:tier: standard
    requirements:
        ResourceRequirement:
            https://platform.illumina.com/rdf/ica/resources:type: himem
            https://platform.illumina.com/rdf/ica/resources:size: small 
            https://platform.illumina.com/rdf/ica/resources:tier: economy
    icav2 projectpipelines start cwl cli-tutorial --data-id fil.a725a68301ee4e6ad28908da12510c25 --input-json '{
      "ipFQ": {
        "class": "File",
        "path": "test.fastq"
      },
      "cwltool:overrides": {
      "tool-fqTOfa.cwl": {
        "requirements": {
          "EnvVarRequirement": {
            "envDef": {
              "MESSAGE": "override_value"
              }
            }                                       
           }
          }
        }
    }' --type-input JSON --user-reference overrides-example
    process split {
        cpus 1
        memory '512 MB'
        
        input:
        path x
        
        output:
        path("split.*.tsv")
        
        """
        split -a10 -d -l3 --numeric-suffixes=1 --additional-suffix .tsv ${x} split.
        """
        }
    process sort {
        cpus 1
        memory '512 MB'
        
        input:
        path x
        
        output:
        path '*.sorted.tsv'
        
        """
        sort -gk1,1 $x > ${x.baseName}.sorted.tsv
        """
    }
    process merge {
      cpus 1
      memory '512 MB'
     
      publishDir 'out', mode: 'move'
     
      input:
      path x
     
      output:
      path 'merged.tsv'
     
      """
      cat $x > merged.tsv
      """
    }
    nextflow.enable.dsl=2
     
    include { sort } from './sort.nf'
    include { split } from './split.nf'
    include { merge } from './merge.nf'
     
    params.myinput = "test.test"
     
    workflow {
        input_ch = Channel.fromPath(params.myinput)
        split(input_ch)
        sort(split.out.flatten())
        merge(sort.out.collect())
    }
    {
      "fields": [
        {
          "id": "myinput",
          "label": "myinput",
          "type": "data",
          "dataFilter": {
            "dataType": "file",
            "dataFormat": ["TSV"]
          },
          "maxValues": 1,
          "minValues": 1
        }
      ]
    }
    function onSubmit(input) {
        var validationErrors = [];
    
        return {
            'settings': input.settings,
            'validationErrors': validationErrors
        };
    }
    function onRender(input) {
    
        var validationErrors = [];
        var validationWarnings = [];
    
        if (input.currentAnalysisSettings === null) {
            //null first time, to use it in the remainder of he javascript
            input.currentAnalysisSettings = input.analysisSettings;
        }
    
        switch(input.context) {
            case 'Initial': {
                renderInitial(input, validationErrors, validationWarnings);
                break;
            }
            case 'FieldChanged': {
                renderFieldChanged(input, validationErrors, validationWarnings);
                break;
            }
            case 'Edited': {
                renderEdited(input, validationErrors, validationWarnings);
                break;
            }
            default:
                return {};
        }
    
        return {
            'analysisSettings': input.currentAnalysisSettings,
            'settingValues': input.settingValues,
            'validationErrors': validationErrors,
            'validationWarnings': validationWarnings
        };
    }
    
    function renderInitial(input, validationErrors, validationWarnings) {
    }
    
    function renderEdited(input, validationErrors, validationWarnings) {
    }
    
    function renderFieldChanged(input, validationErrors, validationWarnings) {
    }
    
    function findField(input, fieldId){
        var fields = input.currentAnalysisSettings['fields'];
        for (var i = 0; i < fields.length; i++){
            if (fields[i].id === fieldId) {
                return fields[i];
            }
        }
        return null;
    }

    India

    ap-south-1

    Indonesia

    ap-southeast-3

    Israel

    il-central-1

    Japan

    ap-northeast-1

    Singapore

    ap-southeast-1

    South Korea*

    ap-northeast-2

    UK

    eu-west-2

    United Arab Emirates

    me-central-1

    United States

    us-east-1

    Australia

    ap-southeast-2

    Canada

    ca-central-1

    Germany

    eu-central-1

    Configuration

    IAM User

    IAM Role

    Considerations

    Synchronization

    Because of how Amazon S3 handles folders and does not send events for S3 folders, the following restrictions must be taken into account for Platform Core project data stored in S3.

    • When you create an empty folder in S3, it will not be visible in Platform Core.

    • When you move folders in S3, the original, but empty, folder will remain visible in Platform Core and must be manually deleted from there.

    • When you delete a folder and its contents in S3, the empty folder will remain visible in Platform Core and must be manually deleted in from there.

    • You can not create a project with ./ as prefix since S3 does not allow uploading files with this key prefix.

    S3 region

    Versioned S3 Buckets

    IAM User
    IAM Role
    IAM user
    IAM roles
    here

    Can’t define java version for connector

    The Service Connector uses Java 11. If you run the installer and encounter the error “Please define INSTALL4J_JAVA_HOME to point to a suitable JVM.”, the installer could not locate a valid Java runtime.

    To resolve the issue, explicitly define the environment variable before running the installation script.

    example:

    export INSTALL4J_JAVA_HOME=/usr/lib/jvm/java-11-openjdk-amd64

    sh illumina_unix_1_13_2_0_35.sh

    Ensure that INSTALL4J_JAVA_HOME points to the Java installation directory (the JRE/JDK root), not the java executable.

    An error in the platform configuration of the upload folder name.
  • For large files, or on slower file systems, the connector needs additional time to start the transfer because it needs to calculate a hash to prevent transfer errors. Wait up to 30 minutes, without making changes to your Connector configuration.

  • If this doesn’t work, you might have a corporate proxy. Proxy configuration is currently not supported for the service connector.

  • A permissions issue. In this case, ensure the user running the connector has read & write access, without a password being requested, to the network share.
  • If there are no messages indicating the folder cannot be found, wait until the integrity checks are completed. This check can take considerable time depending on the file systems and network speeds.

  • Slow Data Transfers

    Speed is affected by a number of factors which can change when switching locations (e.g. working from home):

    • Distance between upload location and storage location

    • Quality of the internet connection (use preferably wired connections)

    • Company- or provider-related bandwidth restrictions

    Upload or download progress % goes down instead of up.

    This is normal behavior. Instead of one continuous transmission, data is split into blocks so if transmission issues occur, not all data has to be retransmit. This can result in dropping back to a lower % of transmission completed when retrying.

    Service connector not connecting

    First restart your computer. If that does not solve the problem, open the Services application (enter services.msc in the windows search bar). In there, there should be a service called Illumina Service Connector.

    • If the service is not running, start it (right mouse click -> start)

    • If the service is running, and still does not connect, you might be on a network with a proxy server. Proxy configuration is currently not supported for the connector.

    • If you do not have a corporate proxy, and your connector still doesn’t connect, contact Illumina Technical Support, and include your connector BSC.out log files.

    Service connector not connecting

    Check if the Connector is running. If it is, there will be an Illumina icon in your Dock.

    • If the service is not running, log out and log back in. An Illumina service connector icon should appear in your dock.

    • If not, try starting the Connector manually from the Launchpad menu.

    • If the service is running, and still does not connect, you might be on a network with a proxy server. Proxy configuration is currently not supported for the connector.

    • If you do not have a corporate proxy, and your connector still doesn’t connect, contact Illumina Technical Support, and include your connector BSC.out log files.

    Corrupted installation script

    If you get the following error message “gzip: sfx_archive.tar.gz: not in gzip format. I am sorry, but the installer file seems to be corrupted. If you downloaded that file please try it again. If you transfer that file with ftp please make sure that you are using binary mode.”

    This indicates the installation script file is corrupted. Please re-download the installation script from Platform Core. Actions like editing the shell script will cause it to be corrupt.

    Unsupported version error in log file

    If the log file gives the following error "Unsupported major.minor version 52.0", an unsupported version of java is present. The connector uses java version 11.

    Manage the connector via the CLI

    Connector installation issues:

    • Make the connector installation script executable with: chmod +x illumina_unix_develop.sh

    • Once it has been made executable, run the installation script with: bash illumina_unix_develop.sh

    • It may be necessary to run with sudo depending on user permissions on the system: sudo bash illumina_unix_develop.sh

    • If installing on a headless system, use the -c flag to do everything from the command line: bash illumina_unix_develop.sh -c

    • Start connector with logging directly to the terminal stdout) (this should be used when the log file is not present, which can be caused by the absence of java 11). From within the installation directory run: ./illuminaserviceconnector run

    • Check status of connector. From within the install location run: ./illuminaserviceconnector status

    • Stop the connector with: ./illuminaserviceconnector stop

    • Restart the connector with: ./illuminaserviceconnector restart

    Windows

    OSX

    Linux

    Shared Drives
    Shared Drives

    x

    move

    x

    x

    x

    x

    x

    manual link

    x

    x

    x

    project connector

    x

    x

    x

    Under Data Sharing ensure the value is set to Yes
  • Select Save

  • Check the box next to Active to ensure the connector will be active.

  • Name (required) — Provide a unique name for the connector.

  • Type (required) — Select the data type that will be linked (either File or Sample)

  • Source Project - Select the source project where data will be linked from.

  • Filter Expression (optional) — Enter an expression to restrict which files will be linked via the connector (see Filter Expression Examples below)

  • Tags (optional) — Add tags to restrict what data will be linked via the connector. Any data in the source project with matching tags will be linked to the destination project.

  • Starts with 'Sample-':

    [?($.details.name =~ /Sample-.*/)]

  • Contains '_R1_':

    [?($.details.name =~ /.*_R1_.*/)]

  • copy

    x

    x

    Prepare Source Project

    Creating a New Project Connector

    Filter Expression Examples

    x

    96 hour limit

    1m (not counted)

    7m (not counted)

    2m (not counted)

    20m

    25m

    10m

    30m

    1m

    -

    Status in Platform Core

    status requested

    status queued

    status initializing

    status preparing inputs

    status in progress

    status in progress

    status in progress

    status generating outputs

    status succeeded

    process {
        maxRetries = 4
        errorStrategy = { sleep(task.attempt * 60000 as long); return'retry'} // Retry with increasing delay
    }

    Analysis task

    request

    queued

    initializing

    input download

    single task

    queue

    parallel tasks

    generating outputs

    trace.enabled = true
    trace.file = '.ica/user/trace-report.txt'
    trace.fields = 'task_id,hash,native_id,process,tag,name,status,exit,module,container,cpus,time,disk,memory,attempt,submit,start,complete,duration,realtime,queue,%cpu,%mem,rss,vmem,peak_rss,peak_vmem,rchar,wchar,syscr,syscw,read_bytes,write_bytes,vol_ctxt,inv_ctxt,env,workdir,script,scratch,error_action'
    Dynamic retry with backoff
    Nextflow on Kubernetes: Best Practices
    The State of Kubernetes in Nextflow

    completed

  • Static - A static cluster has a manager node and a static number of members. At start-up of the cluster, the system ensures the predefined number of members are added to the cluster. These nodes will keep running as long as the entire cluster runs. The system will not automatically remove or add nodes depending on the job load. This gives the fastest resource availability, but at additional cost as unused nodes stay active, waiting for work.

  • Dynamic - A dynamic cluster has a manager node and a dynamic number of workers up to a predefined maximum (with a hard limit of 50). Based on the job load the system will scale the number of members up or down. This saves resources as only as much worker nodes as needed to perform the work are being used.

  • You manage Bench Clusters via the Platform Core UI in Projects > your_project > Bench > Workspaces > your_workspace > Details.

    The following settings can be defined for a bench cluster:

    Field
    Description

    Separate Docker image for cluster manager and members.

    When set to true, you can select a different Docker image for the cluster manager to do the orchestration and the cluster members to do the work.

    Docker image

    Available when separate Docker image for cluster manager and members is selected. Here, you select the Docker image of your cluster manager.

    Web access

    Enable or disable web access to the cluster manager.

    Once the workspace is started, the cluster can be started at Projects > your_project > Bench > Workspaces > your_workspace > Details and the cluster can be stopped without stopping the workspace. Stopping the workspace will also stop all clusters in that workspace.

    Data in a bench workspace can be divided into three groups:

    • Workspace data is accessible in read/write mode and can be accessed from all workspace components (workspace node, cluster manager node, cluster member nodes ) at /data. The size of the workspace data is defined at the creation of the workspace but can be increased when editing a workspace in the Platform Core UI. This is persistent storage and data remains when a workspace is shut down.

    • Project data can be accessed from all workspace components at /data/project. Every component will have their own dedicated mount to the project. Depending on the project data permissions you will be able to access it in either Read-Only or Read-Write mode.

    • Scratch data is available on the cluster members at /scratch and can be used to store intermediate results for a given job dedicated to that member. This is temporary storage, and all data is deleted when a cluster member is removed from the cluster.

    All mounts occur in /data/mounts/, see data access and workspace-ctl data.

    Managing these mounts is done via the workspace cli /data/.local/bin/workspace-ctl in the workspace. Every node will have his dedicated mount.

    For fast data access, bench offers a mount solution to expose project data on every component in the workspace. This mount provides read-only access to a given location in the project data and is optimized for high read throughput per single file with concurrent access to files. It will try to utilise the full bandwidth capacity of the node.

    All mounts occur in path /data/mounts/

    For fast read-only access, link folders with the CLI command workspace-ctl data create-mount --mode read-only.

    Managing a Bench cluster

    Introduction

    Clusters can run in two modes.

    workspace-ctl data get-mounts
    workspace-ctl data create-mount --mount-path /data/mounts/mydata --source /data/project/mydata
    workspace-ctl data delete-mount --mount-path /data/mounts/mydata

    Configuration

    Operations

    Managing Data in a Bench cluster

    Fast Read-Only Access

    Show mounts

    Creating a mount

    This has the same effect as using the --mode read-only option because this is applied by default when using workspace-ctl data create-mount .

    Removing a mount

    fastqc
    command is responsive and prints the expected help message. Remember to
    exit
    the container.

    Save a tar of the previously built image locally:

    Upload your docker image .tar to a Platform Core project using browser upload, Connector, or CLI.

    Now go outside of the Project and go to System Settings > Docker Repository, Select Create > Image. Select your docker file and fill out a name and version and set your type to tool and Press Select.

    While outside of any Project go to System Settings > Tool Repository and Select +Create. Fill the mandatory fields (Name and Version) and look for a Docker image to link to the tool.

    Tool creation in Platform Core adheres to the CWL standard.

    You can create a tool by either pasting the tool definition in the code syntax field on the right or you can use the different tabs to manually define inputs, outputs, arguments, settings, etc …

    In this tutorial we will use the CWL tool syntax method. Paste the following content in the General tab.

    Since the user needs to specify the output folder for FASTQC application (-o prefix), we are using the $(runtime.outdir) runtime parameter to point to the designated output folder.

    Navigate to Projects > your_project > Flow > Pipelines > +Create > CWL Graphical.

    Fill the mandatory fields and click on the Definition tab to open the Graphical Editor.

    Expand the Tool Repository menu (lower right) and drag your FastQC tool into the Editor field (center).

    Now drag one Input and one Output file icon (on top) into the Editor field as well. Both may be given a Name (editable fields on the right when icon is selected) and need a Format attribute. Set the Input Format to fastq and Output Format to html. Connect both Input and Output files to the matching nodes on the tool itself (mouse over the node, then hold-click and drag to connect).

    Press Save, you just created your first FastQC pipeline on Platform Core!

    FastQC

    First make sure you have at least one Fastq file uploaded and/or linked to your Project. You may use Fastq files available in the Bundle.

    Navigate to Pipelines and select the pipeline you just created, then press Start analysis

    Fill the mandatory fields and click on the + button to open the File Selection dialog box. Select one of the Fastq files available to you.

    Press Start analysis on the top right, the platform is now orchestrating the pipeline execution.

    Navigate to Projects > your_project > Flow > Analyses and observe that the pipeline execution is now listed and will first be in Status Requested. After a few minutes the Status should change to In Progress and then to Succeeded.

    Once this Analysis succeeds click it to enter the Analysis details view. You will see the FastQC HTML output file listed on the Output files tab. Click on the file to open Data Details view. Since it is an HTML file Format there is a View tab that allows visualizing the HTML within the browser.

    FROM centos:7
    WORKDIR /usr/local
    
    # DEPENDENCIES
    RUN yum -y install java-1.8.0-openjdk wget unzip perl && \
        yum clean all && \
        rm -rf /var/cache/yum
    
    # INSTALLATION fastqc
    RUN wget http://www.bioinformatics.babraham.ac.uk/projects/fastqc/fastqc_v0.11.9.zip --no-check-certificate && \
        unzip fastqc_v0.11.9.zip && \
        chmod a+rx /usr/local/FastQC/fastqc && rm -rf fastqc_v0.11.9.zip
    
    # Adding FastQC to the PATH
    ENV PATH $PATH:/usr/local/FastQC
    
    # DEFAULTS
    ENV LANG=en_US.UTF-8
    ENV LC_ALL=en_US.UTF-8
    ENTRYPOINT []
    
    ## how to build the docker image
    ## docker build --file fastqc-0.11.9.Dockerfile --tag fastqc-0.11.9:0 .
    ## docker run --rm -i -t --entrypoint /bin/bash fastqc-0.11.9:0
    docker build --file fastqc-0.11.9.Dockerfile --tag fastqc-0.11.9:1 .
    docker images
    docker run --rm -i -t --entrypoint /bin/bash fastqc-0.11.9:1

    Build and push your own Docker image to Platform Core

    docker save fastqc-0.11.9:1 -o fastqc-0.11.9:1.tar.gz
    #!/usr/bin/env cwl-runner
    
    # (Re)generated by BlueBee Platform
    
    $namespaces:
      ilmn-tes: http://platform.illumina.com/rdf/iap/
    cwlVersion: cwl:v1.0
    class: CommandLineTool
    label: FastQC
    doc: FastQC aims to provide a simple way to do some quality control checks on raw
      sequence data coming from high throughput sequencing pipelines.
    inputs:
      Fastq1:
        type: File
        inputBinding:
          position: 1
      Fastq2:
        type:
        - File
        - 'null'
        inputBinding:
          position: 3
    outputs:
      HTML:
        type:
          type: array
          items: File
        outputBinding:
          glob:
          - '*.html'
      Zip:
        type:
          type: array
          items: File
        outputBinding:
          glob:
          - '*.zip'
    arguments:
    - position: 4
      prefix: -o
      valueFrom: $(runtime.outdir)
    - position: 1
      prefix: -t
      valueFrom: '2'
    baseCommand:
    - fastqc

    In Projects > your_project > Data, select the uploaded .tar file, then click Manage > Change Format , select DOCKER and Save.

    Create a CWL tool

    Other tabs, except for the Details tab can also be used.

    Create the pipeline

    Run a pipeline

    View Results

    Troubleshooting AWS-S3 Connectivity

    Common Issues

    The following are common issues encountered when connecting an AWS S3 bucket through a storage configuration

    Error Type
    Error Message
    Description/Fix

    Access Forbidden

    Access forbidden: {message}

    Mostly occurs because of lack of permission. Fix: Review IAM policy, Bucket policy, ACLs for required permissions

    This error occurs when an existing bucket notification's event information overlaps with the notifications Platform Core is trying to add. only allows overlapping events with non-overlapping prefix. Depending on the conflicts on the notifications, the error can be presented in any of the following:

    • Volume Configuration cannot be provisioned: storage container is already set up for customer's own notification.

    • Invalid parameters for volume configuration: found conflicting storage container notifications with overlapping prefixes.

    • Failed to update bucket policy: Configurations overlap. Configurations on the same bucket cannot share a common event type.

    Solution:

    1. In the Amazon S3 Console, review your current S3 bucket's notification configuration and look for prefixes that overlap with your Storage Configuration's key prefix.

    2. Delete the existing notification that overlaps with your Storage Configuration's key prefix.

    3. Platform Core will perform a series of steps in the background to re-verify the connection to your bucket.

    This error can occur when recreating a recently deleted storage configuration. To fix the issue, you have to delete the bucket notifications:

    1. In the select the bucket for which you need to delete the notifications from the list.

    2. Choose properties.

    3. Navigate to the Event Notifications section and choose the check box for the event notifications with name gds:objectcreated, gds:objectremoved and gds:objectrestore and click Delete.

    Storage

    A storage configuration provides Platform Core with information to connect to an external cloud storage provider, such as AWS S3. The storage configuration validates that the information provided is correct, and then continuously monitors the integration.

    Refer to the following pages for instructions to setup supported external cloud storage providers:

    • Connect AWS S3 Bucket

    Credentials

    The storage configuration requires credentials to connect to your storage. AWS uses the security credentials to authenticate and authorize your requests. On the System Settings > Credentials > Create > Storage Credential, you can enter these credentials.

    Fill out the following fields:

    • Type - The type of access credentials. This can be either AWS USER or AWS ROLE.

    • Name - Provide a name to easily identify your access key.

    • Access key ID (AWS user only) - The access key you created.

    • Secret access key (AWS user only) - Your related secret access key.

    • RoleSessionName prefix (AWS role only) - generated by using the generate button. This value must be included in the . for the specified AWS role. You can only download or copy this value now during creation. Once this dialog box closes after saving, you can no longer access this value.

    You can share the credentials you own with other users of your tenant. To do so select your credentials at System Settings > Credentials and choose Share.

    For more information, refer to the documentation.

    1. In the Platform Core main navigation, select System Settings > Storage > Create.

    2. Configure the following settings for the storage configuration.

      • Type - Always use the default value here (AWS_S3).

    Platform Core performs a series of steps in the background to verify the connection to your bucket. This can take several minutes. You may need to manually refresh the list to verify that the bucket was successfully configured. Once the storage configuration setup is complete, the configuration can be used while .

    With the action Manage > Set as default for region, you select which storage will be used as default storage in a region for new projects of your tenant. Only one storage can be default at a time for a region, so selecting a new storage as default will unselect the previous default. If you do not want to have a default, you can select the default storage and the action will become Unset as default for region.

    The System Settings > Credentials > select your credentials > Manage > Share action is used to make the storage available to everyone in your tenant. By default, storage is private per user so that you have complete control over the contents. Once you decide you want to share the storage, simply select it and use the Share action. Do take into account that once shared, you can not unshare the storage. Once your shared storage is used in a project, it can also no longer be deleted.

    In the Platform Core main navigation, select System Settings > Storage > select your storage > Manage > Delete. You can then create a new storage configuration to reuse the bucket name and key prefix.

    Every 4 hours, Platform Core will verify the storage configuration and credentials to ensure availability. When an error is detected, Platform Core will attempt to reconnect once every 15 minutes. After 200 consecutively failed connection attempts (50 hours), Platform Core will stop trying to connect.

    When you update your credentials, the storage configuration is automatically validated. In addition, you can manually trigger revalidation when Platform Core has stopped trying to connect by selecting the storage and then clicking Validate on the System Settings > Storage > select your storage > Manage > Validate.

    Refer to this for the troubleshooting guide.

    Platform Core supports the following storage classes. Please see the for more information on each:

    Object Class
    ICA Status

    IAM User Method

    To use the IAM user method, you need to:

    • Set browser access to the S3 bucket (CORS).

    • Create data access permissions (IAM policy).

    • Create the IAM user and AWS access key and propagate them to Platform Core.

    • Verify S3 .

    • To use copy and move operations, you need to add the necessary in the S3 bucket policy.

    Optional steps:

    • It is also best practice to to the S3 bucket.

    • If your bucket is KMS-enabled, follow the additional steps described .

    1

    Platform Core requires cross-origin resource sharing (CORS) permissions to write to the S3 bucket for uploads via the browser. Refer to (expand the Using the S3 console section) documentation for instructions on enabling CORS via the AWS Management Console.

    In the cross-origin resource sharing (CORS) section, enter the following content.

    2

    Platform Core requires specific permissions to access data in an AWS S3 bucket. These permissions are contained in an AWS IAM Policy.

    Object tags are copied when performing Copy, Move, Archive and Unarchive Operations within the same account or across accounts when using your own S3 storage.

    If there is an issue with copying, verify you have the required permission in your policies

    • In the configuration above, the s3:GetObjectTagging and s3:PutObjectTagging are part of the .

    • s3:GetObjectTagging and s3:PutObjectTagging are part of the .

    • For cross-account copy or move operations, s3:GetObjectTagging and s3:PutObjectTagging are included in the .

    nf-core Pipelines

    Introduction

    This tutorial shows you how to

    • Import any nf-core pipeline from their public repository.

    • Run the pipeline in Bench.

      • monitor the execution

    • .

    • Start Bench workspace

      • For this tutorial, the instance size depends on the flow you import, and whether you use a Bench cluster:

        • If using a cluster, choose standard-small or standard-medium for the workspace master node

    If conda and/or nextflow are not installed, pipeline-dev will offer to install them.

    The Nextflow files are pulled into the nextflow-src subfolder.

    All nf-core pipelines conveniently define a "test" profile that specifies a set of validation inputs for the pipeline.

    The following command runs this test profile. If a Bench cluster is active, it runs on your Bench cluster, otherwise it runs on the main workspace instance.

    When a pipeline is running locally (i.e. not on a Bench cluster), you can monitor the task execution from another terminal with docker ps

    When a pipeline is running on your Bench cluster, a few commands help to monitor the tasks and cluster. In another terminal, you can use:

    • qstat to see the tasks being pending or running

    • tail /data/logs/sge-scaler.log.<latest available workspace reboot time> to check if the cluster is scaling up or down (it currently takes 3 to 5 minutes to get a new node)

    • The output of the pipeline is in the outdir folder

    • Nextflow work files are under the work folder

    • Log files are .nextflow.log* and output.log

    After generating a few ICA-specific files (JSON input specs for Flow launch UI + list of inputs for next step's validation launch), the tool identifies which previous versions of the same pipeline have already been deployed (in ICA Flow, pipeline versioning is done by including the version number in the pipeline name, so that's what is checked here). It then asks if you want to update the latest version or create a new one.

    Choose "3" and enter a name of your choice to avoid conflicts with other users following this same tutorial.

    At the end, the URL of the pipeline is displayed. If you are using a terminal that supports it, Ctrl+click or middle-click can open this URL in your browser.

    This launches an analysis in ICA Flow, using the same inputs as the nf-core pipeline's "test" profile.

    Some of the input files will have been copied to your ICA project to allow the launch to take place. They are stored in the folder bench-pipeline-dev/temp-data.

    Nextflow DRAGEN Pipeline

    In this tutorial, we will demonstrate how to create and launch a simple DRAGEN pipeline using the Nextflow language in the Platform Core UI. More information about Nextflow on Platform Core can be found here. For this example, we will implement the alignment and variant calling example from this DRAGEN support page for Paired-End FASTQ Inputs.

    Linking a DRAGEN bundle

    You need a project in which the pipeline will reside. You can choose an existing project or create a new one. See the Projects page for information on how to create a project. For this tutorial, we will use a project called Getting Started.

    Once you have selected or created your project, you need to link a DRAGEN bundle to it give the project access to the DRAGEN docker image. Open your project and navigate to Projects > your_project > Project settings > Details > Edit. From here, select the + symbol next to linked bundles and select a DRAGEN Demo Tool bundle to add to the project. For this tutorial, link DRAGEN Demo Bundle 4.0.3.

    Once the bundle has been linked to your project, you can access the docker image by navigating to the main level and opening System Settings > Docker Repository. There, click the docker image dragen-ica-4.0.3. At the bottom of the screen, you will see the regions where this bundle is available.

    Select Projects > your_project > Flow > Pipelines. From the Pipelines view, click +Create > Nextflow > JSON based to start creating a Nextflow pipeline.

    In the Nextflow pipeline creation view, use the Details tab to add information about the pipeline. Add values for the required Code (pipeline name) and Description fields. Nextflow Version and Storage size defaults to preassigned values.

    Next, add the Nextflow pipeline definition by navigating to the Nextflow files > main files > main.nf. You will see a text editor. Copy and paste the following definition into the text editor. Modify the container directive by replacing the current URL with the URL found in the docker image dragen-ica-4.0.3. (System Settings > Docker Repository > your_docker_image > Regions).

    This pipeline performs the following actions:

    1. Accepts one paired FASTQ, one compressed reference file and a sample name

    2. Schedules a FPGA‑backed Kubernetes pod on Platform Core

    3. Unpacks the reference to local scratch

    4. Runs DRAGEN with variant calling

    Refer to the page for details on Platform Core-specific attributes within the Nextflow definition.

    • To specify a compute type for a Nextflow process, use the directive within each process.

    • Outputs for Nextflow pipelines are uploaded from the out folder in the attached shared filesystem. The directive specifies the output folder for a given process. Only data moved to the out folder using the publishDir directive will be uploaded to the Platform Core project after the pipeline finishes executing.

    Next, we create the input form used for the pipeline. This is done on the Inputform files tab. More information on the specifications for the input form can be found in page.

    This pipeline takes two FASTQ files, one reference file and one sample_id parameter as input.

    Paste the following JSON input form into the inputForm.json text editor.

    Click the Simulate button (bottom left) to preview the launch form fields.

    Click the Save button (top right) to save the changes.

    Go to the projects > your_project > flow > pipelines > your_pipeline and click Start Analysis.

    Fill in the required fields and click on Start Analysis button.

    You can monitor the run from the Projects > your_project > Flow > analysis page. Once the Status changes to Succeeded, you can click on the run to access the results.

    Import New Samples

    Import New Samples

    Platform Core Cohorts can pull any molecular data available in a Platform Core project, as well as additional sample- and subject-level metadata information such as demographics, biometrics, sequencing technology, phenotypes, and diseases.

    To import a new data set, select Import Jobs from the left navigation tab underneath Cohorts, and click the Import Files button. The Import Files button is also available under the Data Sets left navigation item.

    The Data Set menu item is used to view imported data sets and information. The Import Jobs menu item is used to check the status of data set imports.

    Confirm that the project shown is the Platform Core project that contains the molecular data you would like to add to Platform Core Cohorts.

    1. Choose a data type among

      • Germline variants

      • Somatic mutations

      • RNAseq

      • GWAS

    2. Choose a new study name by selecting the radio button Create new study and entering a Study Name.

    3. To add new data to an existing Study, select the radio button Select from list of studies and select an existing Study Name from the dropdown.

    4. To add data to existing records or add new records, select Job Type, Append.

    5. Append does not wipe out any data ingested previously and can be used to ingest the molecular data in an incremental manner.

    6. To replace data, select Job Type, Replace. If you are ingesting data again, use the Replace job type.

    7. Enter an optional Study description.

    8. Select the metadata model (default: Cohorts; alternatively, select OMOP version 5.4 if your data is formatted that way.)

    9. Select the genome build your molecular data is aligned to (default: GRCh38/hg38)

    10. For RNAseq, specify whether you want to run differential expression (see below) or only upload raw TPM.

    11. Click Next.

    12. Navigate to VCFs located in the Project Data.

    13. Select each single-sample VCF or multi-sample VCF to ingest. For GWAS, select CSV files produced by Regenie.

      • As an alernative to selecting individual files, you can also opt to select a folder instead. Toggle the radio button on Step 2 from "Select files" to "Select folder".

      • This option is currently only available for germline variant ingestion: any combination of small variants, structural variation, and/or copy number variants.

    14. Click Next.

    15. Navigate to the metadata (phenotype) data tsv in the project Data.

    16. Select the TSV file or files for ingestion.

    17. Click Finish.

    Platform Core Cohorts supports VCF files formatted according to VCF v4.2 and v4.3 specifications. VCF files require at least one of the following header rows to identify the genome build:

    • ##reference=file://... --- needs to contain a reference to hg38/GRCh38 in the file path or name (numerical value is sufficient)

    • ##contig=<ID=chr1,length=248956422> --- for hg38/GRCh38

    • ##DRAGENCommandLine= ... --ht-reference

    Platform Core Cohorts accepts VCFs aligned to hg38/GRCh38 and hg19/GRCh37. If your data uses hg19/GRCh37 coordinates, Cohorts will convert these to hg38/GRCh38 during the ingestion process [see Reference 1]. Harmonizing data to one genome build facilitates searches across different private, shared, and public projects when building and analyzing a cohort. If your data contains a mixture of samples mapped to hg38 and hg19, please ingest these in separate batches, as each import job into Cohorts is limited to one genome build.

    As an alternative to VCFs, Platform Core Cohorts accepts the JSON output of for hg38/GRCh38-aligned data for small germline variants and somatic mutations, copy number variations and other structural variants.

    Platform Core Cohorts can process gene- and transcript-level quantification files produced by the Illumina DRAGEN RNA pipeline. The file naming convention needs to match .quant.genes.sf for genes and .quant.sf for transcript-level TPM.

    Please also see the online documentation for the for more information on output file formats.

    Platform Core Cohorts currently supports upload of SNV-level GWAS results produced by and saved as CSV files.

    As an alternative to Platform Core Cohorts metadata file format, you can provide files formatted according to the . Cohorts currently ingests data for these OMOP 5.4 tables, formatted as tab-delimited files:

    • PERSON (mandatory),

    • CONCEPT (mandatory if any of the following is provided),

    • CONDITION_OCCURRENCE (optional),

    • DRUG_EXPOSURE (optional), and

    Additional files such as measurement and observation will be supported in a subsequent release of Cohorts.

    [1] VcfMapper:

    [2] crossMap:

    [3] liftOver:

    [4] Chain files:

    Git-Sourced Pipelines

    Introduction

    Git can be used as source-control system for your pipelines. This offers portability, versioning and easy integration of existing public pipelines.

    To use Git-sourced pipelines:

    1. If you want to use a private repository, Create Git credentials with your personal access tokens.

    2. Configure in Platform Core where on GitHub the pipeline is located, which tag or commit-id of that pipeline to use and select the credentials if it is a private repository or to prevent rate limiting.

    To access private pipelines stored on Git, you need to enter the Git credentials in Platform Core. This is done at System Settings > Credentials > Create > Git Credential. If you want to use a public repository, you do not need credentials or an access token. However, there is a limit to how many anonymous calls can be made to a GitHub repository, so if that limit is exceeded, you will encounter repo lookup rate limit reached and will not be able to import the pipeline. For this reason, it is best practice to use Git credentials even for public repositories.

    Fill out the following fields:

    • Name—Provide a name to easily identify your Git credentials

    • Git url—This is fixed to

    • Personal Access Token —the personal access token. Either an existing one, or you can one on Git. When you save and reopen your credentials, the personal access token is hidden. If you want to make changes to the credentials, you will need to re-enter the personal access token. This is to prevent the access token from being copied.

    A link is provided to create your on in case you do not have a token.

    You can share the credentials you own with other users of your tenant. To do so, select your credentials at System Settings > Credentials and choose Share. Those users will be able to use your credentials, but they will not be able to see the actual access token.

    Personal access tokens work in the same way as OAuth access tokens. You can create a new personal access token at .

    • The personal access token must have scope:repo (meaning all elements in the repo category must be selected).

    • If you set an expiration date, all pipelines which use this personal access token will stop working on that date. For this reason, it is advised not to set an expiration date unless absolutely necessary.

    Select Generate token at the bottom of the screen to get your personal access token. Copy the value over to a secure location after generating it.

    Regardless of using a public or a private repository, you need to create the connection in Platform Core to pick up pipeline the from Git.

    1. Create a new pipeline at Projects > your_project > flow > Pipelines > Create > Nextflow > from Git.

    2. Fill out the fields to access the pipeline. During configuration, a test will be performed to see if the repository can be reached with the provided credentials. Even if the tests fail, you can still save the entered values, this is to prevent you from being blocked from creating a configuration if the repository is unavailable. If you enter the URL for a private repository before you have entered the credentials, Platform Core will try to access it as if it were a public GitHub URL until you have entered the credentials.

    1. Select Create to start importing the pipeline. During import, the inputForm.json file is generated from the nextflow_schema.json file.

      • While the pipeline is being imported, you can still choose Abort import by opening the pipeline details if you decide not to import the pipeline.

      • If the import fails, you can investigate the reason by opening the pipeline and looking at the import summary on the details tab

    The following restrictions apply to Git-sourced pipelines.

    • Only JSON-based NextFlow are supported, no CWL pipelines or XML-based pipelines.

    • Because translation from the generic nextflow pipeline to the ica-specific input forms takes place during import, you cannot use input forms created in Platform Core in your GitHub repository as the system will try to reconvert them.

    • Only is supported as repository location.

    Metadata Models

    Illumina Connected Analytics allows you to create and assign metadata to capture additional information about samples.

    Every tenant has a root metadata model that is accessible to all projects of that tenant. This allows an organization to collect the same piece of information, such as an ID number, for every sample in every project. Within this root model, you can configure multiple metadata submodels, even at different levels. These submodels inherit all fields and groups from their parent models.

    Illumina recommends that you limit the amount of fields or field groups you add to the root model. Fields can have various types containing single or multiple values and field groups contain fields that belong together, such as all fields related to quality metrics. If there are any misconfigured items in the root model, it will carry over into all other tenant metadata models. Once a root model is published, the fields and groups that are defined within it cannot be deleted, only more fields can be added.

    When configuring a project, you can assign a published metadata model for all samples in the project. This metadata model can be any published metadata model in your tenant such as the root model, or one of the lower level submodels. When a metadata model is selected for a project, all fields configured for the metadata model, and all fields in any parent models are applied to the samples in the project.

    Basic Git-Sourced Pipeline Example

    This section describes how to configure the nf-core demo pipeline from to run in Platform Core.

    1. Create a new pipeline at Projects > your_project > flow > Pipelines > Create > Nextflow > from Git.

    2. Fill out the following details:

    Data Catalogue

    Data Catalogues provide views on data from Illumina hardware and processes (Instruments, Cloud software, Informatics software and Assays) so that this data can be distributed to different applications. This data consists of read-only tables to prevent updates by the applications accessing it. Access to data catalogues is included with professional and enterprise subscriptions.

    Project-level views

    • ICA_PIPELINE_ANALYSES_VIEW (Lists project-specific Platform Core pipeline analysis data)

    • ICA_DRAGEN_QC_METRIC_ANALYSES_VIEW (project-specific quality control metrics)

    Query

    Queries can be used for data mining. On the Projects > your_project > Base > Query page:

    • New queries can be created and executed

    • Already executed queries can be found in the query history

    • Saved queries and query templates are listed under the saved queries tab.

    Create a Cohort

    Platform Core Cohorts lets you create a research cohort of subjects and associated samples based on the following criteria:

    • Project:

      • Include subjects that are part of any Platform Core project that you own or that is shared with you.

    inputForm.json

    The JSON schema allowing you to define the input parameters. See the page for syntax details.

    Type
    Usage

    Nextflow CLI

    In this tutorial, we will demonstrate how to create and launch a Nextflow pipeline using the Platform Core command line interface (CLI).

    Please refer to for installing the Platform Core CLI. To authenticate, please follow the steps in the page.

    In this tutorial, we will create the pipeline in Platform Core, which includes four processes:

    • index creation

    SSE-KMS Encryption

    This section describes how to connect an AWS S3 Bucket with enabled. General instructions for configuring your AWS account to allow Platform Core to connect to an S3 bucket are found on .

    Follow the for how to create S3 bucket with SSE-KMS key.

    In the "Default encryption" section, enable Server-side encryption and choose AWS Key Management Service key (SSE-KMS). Then select Choose your AWS KMS key.

    Follow the for connecting an S3 bucket to Platform Core.

    Alternatively, INSTALL4J_JAVA_HOME_OVERRIDE can also be used, but using INSTALL4J_JAVA_HOME is recommended

    Dedicated Cluster Manager

    Use a dedicated node for the cluster manager. This reserves an entire machine (based on the selected resource model) for the cluster manager. If no dedicated cluster manager is selected, one core per cluster member is reserved for scheduling. For example, if you have 2 nodes of standard-medium (4 cores) and no dedicated cluster manager, then only 6 (2×3) cores are available to run tasks, because each node reserves 1 core for cluster management.

    Resource model

    Available when dedicated cluster manager is selected. This is the resource model on which the cluster manager will run.

    Include ephemeral storage

    Available when dedicated cluster manager is selected. Select this to create scratch space for your nodes. Enabling it makes the storage size selector appear. Data stored in this space is deleted when the instance is terminated. When you deselect this option, the storage size is 0.

    Storage size

    Available when ephemeral storage is selected. How much storage space (1 GB–16 TB) to reserve per node as dedicated scratch space, available at /scratch.

    Docker image

    Available when separate Docker image for cluster manager and members is selected. Here, you select the Docker image of your cluster members.

    Type

    Choose between Static and Dynamic.

    Number of nodes / Scaling interval

    For static, set the number of cluster member nodes (maximum 50). For dynamic, choose the minimum and maximum number of cluster member nodes (up to 50).

    Resource model

    The type of machine on which cluster members run. For each cluster member, one machine of this type is provisioned. Consider the cost impact when running many machines with a high individual cost.

    Economy mode

    Economy mode uses AWS Spot Instances. This halves many compute iCredit rates compared to standard mode, but instances can be interrupted. See Pricing for a list of supported resource models.

    Include ephemeral storage

    Select this to create scratch space for your nodes. Enabling it makes the storage size selector appear. Data stored in this space is deleted when the instance is terminated. When you deselect this option, the storage size is 0.

    Storage size

    Available when ephemeral storage is selected. How much storage space (1 GB–16 TB) to reserve per node as dedicated scratch space, available at /scratch.

    revalidate the current storage configuration for an immediate update on the System Settings > Storage > Manage > Validate.

    Unsupported principal

    Unsupported principal: The policy type ${policy_type} does not support the Principal element. Remove the Principal element.

    This can indicate that the S3 bucket policy settings have been added to the IAM policy by mistake.

    Conflict

    System topic is not in a valid state

    Conflict

    Found conflicting storage container notifications with overlapping prefixes

    See Conflicting bucket notifications

    Conflict

    Found conflicting storage container notifications for {prefix}{eventTypeMsg}

    See Conflicting bucket notifications

    Conflict

    Found conflicting storage container notifications with overlapping prefixes{prefixMsg}{eventTypeMsg}

    See Conflicting bucket notifications

    Customer Container Notification Exists

    Volume Configuration cannot be provisioned: storage container is already set up for customer's own notification

    See Conflicting bucket notifications

    Invalid Access Key ID

    Failed to update bucket policy: The AWS Access Key Id you provided does not exist in our records.

    Check the status of the AWS Access Key ID in the console. If not active, activate it. If missing, create it.

    Invalid Paramater

    Missing credentials for storage container

    Check the storage credential. AccessKeyId and/or SecretAccessKey is not set.

    Invalid Parameter

    Missing bucket name for storage container

    Bucket name has not been set for the storage configuration.

    Invalid Parameter

    The storage container name has invalid characters

    Storage container name can only contain lowercase letters, numbers, hyphens, and periods.

    Invalid Parameter

    Storage Container '{storageContainer}' does not exist

    Update storage configuration container to a valid s3 bucket.

    Invalid Parameter

    Invalid parameters for volume configuration: {message}

    Invalid Storage Container Location

    Storage container must be located in the {region} region

    Update storage configuration region to match storage container region.

    Invalid Storage Container Location

    Storage container must be located in one of the following regions: {regions}

    Update storage configuration region to match storage container region.

    Incorrect bucket Object Ownership

    A copy job to your bucket does not complete (appears stuck), or fails with a 403 / access-denied error, even though the connection/health check for your bucket passes.

    1. In the AWS S3 console, set the bucket's Object Ownership to ACLs disabled (Bucket owner enforced) via the Permissions tab, then Object Ownership, then Edit.

    2. Re-run the copy job.

    Note: Changing this setting fixes all new copies. Files that were already copied while the setting was incorrect are not retroactively fixed and must be copied again.

    Missing Configuration

    Missing queue name for storage container notification

    Missing Configuration

    Missing system topic name for storage container notification

    Missing Configuration

    Missing lambda ARN for storage container notification

    Missing Configuration

    Missing subscription name for storage container notification

    Missing Storage Account Settings

    The storage account '{storageAccountName}' needs HNS (Hierarchical Namespace) enabled.

    Missing Storage Container Settings

    Missing settings for storage container

    Specific Errors

    Conflicting bucket notifications

    GetTemporaryUploadCredentialsAsync failure

    If you do not want to wait revalidate, you can wait 15 minutes, for the storage to become available in Platform Core.

    Amazon S3 event notification
    Amazon S3 Console
    Region - Select the region where the bucket is located.
  • Configuration name - You will use this name when creating volumes that reside in the bucket. The name length must be in between 3 and 63 characters.

  • Description - Here you can provide a description for yourself or other users to identify this storage configuration.

  • Bucket name - Enter the name of your S3 bucket.

  • Key prefix - You can provide a key prefix to allow only files inside the prefix to be accessible. Although this setting is optional, it is highly recommended to use a key prefix and mandatory when using dedicated folders in your S3 storage. The key prefix must end with "/".

    • If a key prefix is specified, your projects will only have access to that folder and subfolders. For example, using the key prefix folder-1/ ensures that only the data from the folder-1 folder in your S3 bucket is synced with your Platform Core project. Using prefixes and distinct folders for each Platform Core project is the recommended configuration as it allows you to use the same S3 bucket for different projects.

    • Using no key prefix (not recommended) results in syncing all data in your S3 bucket (starting from root level) with your Platform Core project. Your project will have access to your entire S3 bucket, which prevents that S3 bucket from being used for other Platform Core projects.

  • Storage Credential - Select the credentials to associate with this storage configuration. These were created on System Settings > Credentials > Create > Storage Credential.

  • Role ARN (AWS ROLE) - This value needs to be copied from your Role in AWS, so this step can only be completed after performing the steps described in the IAM Role method.

  • Server Side Encryption [Optional]—If needed, you can enter the algorithm and key name for server-side encryption processes.

  • Select Save.

  • S3 Standard-IA

    Available

    S3 One Zone-IA

    Available

    S3 Glacier Instant Retrieval

    Available

    S3 Glacier Flexible Retrieval

    Archived

    S3 Glacier Deep Archive

    Archived

    Reduced redundancy (not recommended)

    Available

    S3 Standard

    Available

    S3 Intelligent-Tiering

    Available

    S3 Express One Zone

    Available

    Create a Storage Configuration

    Filenames beginning with / are not allowed, so be careful when entering full path names. Otherwise the file will end up on S3 but not be visible in Platform Core. If this happens, access your S3 storage directly and copy the data to where it was intended. If you are using an Illumina-managed S3 storage, submit a support request to delete the erroneous data.

    Deleting Storage Configurations

    Hiding a project will also unlock your storage configuration so that it can be reused for another project. Data stored by the hidden project will remain in your S3 storage, so you may need to perform manual cleanup before reusing the storage.

    Storage Configuration Verification

    Supported Storage Classes

    If you are using Intelligent Tiering, which allows S3 to automatically move files into different cost-effective storage tiers, please do NOT include the Archive and Deep Archive Access tiers, as these are not supported by Platform Core yet. Instead, you can use lifecycle rules to automatically move files to Archive after 90 days and Deep Archive after 180 days. Lifecycle rules are supported for user-managed buckets.

    trust policy
    AWS security credentials
    creating a new project
    page
    AWS documentation
    Platform Core Cohorts will scan the selected folder and all sub-folders for any VCF files or JSON files and try to match them against the Sample ID column in the metadata TSV file in Step 3.
  • Files not matching sample IDs will be ignored; allowed file extensions for VCF files after the sample ID are: *.vcf.gz, *.hard-filtered.vcf.gz, *.cnv.vcf.gz, and *.sv.vcf.gz .

  • Files not matching sample IDs will be ignored; allowed file extensions for JSON files after the sample ID are: .json,.json.gz, *.json.bgz, *.json.gzip.

  • Job type

    Append: Appends values to any existing values. If a field supports only a single value, the value is replaced.

    Replace: Overwrites existing values with the values in the uploaded file.

    Subject metadata files

    Subject metadata file(s) in tab-delimited format. For Append and Replace job types, the following fields are required and cannot be changed: - Sample identifier - Sample display name - Subject identifier - Subject display name - Sex

    PROCEDURE_OCCURRENCE (optional.)

    Field

    Description

    Project name

    The Platform Core project for your cohort analysis (cannot be changed.)

    Study name

    Create or select a study. Each study represents a subset of data within the project.

    Description

    Short description of the data set (optional).

    Search Spinner behavior in input jobs table

    • Search a term and press ** Enter.

    • The search spinner will appear while the results are loading.

    • Once the results are displayed in the table, the spinner will disappear immediately

    All VCF types, specifically from DRAGEN, can be ingested using the Germline variants selection. Cohorts will distinguish the variant types that it is ingesting. If Cohorts cannot determine the variant file type, it will default to ingest small variants.

    Alternatively to VCFs, you can select Nirvana JSON files for DNA variants: small variants, structural variants, and copy number variation.

    The maximum amount of files that can be part of a single manual ingestion batch is capped at 1000

    You can also choose a single folder and Platform Core Cohorts will identify all ingestible files within that folder and its sub-folders. In this scenario, Cohorts will select molecular data files matching the samples listed in the metadata sheet, which is the next step in the import process.

    You have the option to ingest either VCF files or Nirvana JSON files for any given batch, regardless of the chosen ingestion method.

    The sample identifiers used in the VCF columns need to match the sample identifiers used in subject/sample metadata files; accordingly, if you are starting from JSON files containing variant- and gene-level annotations provided by ILMN Nirvana, the samples listed in the header need to match the metadata files.

    Variant file formats

    RNAseq file format

    GWAS file format

    Metadata and File Types

    If annotating large sets of samples with molecular data, expect the annotation process to take over 20 minutes per whole genome batch of samples. You will receive two e-mail notifications: once your ingestion starts and once completed successfully or failed.

    Cohorts requires that all such files do not deviate from the OMOP CDM 5.4 standard. Depending on your implementation, you may have to adjust file formatting to be OMOP CDM 5.4-compatible.

    References

    Illumina Nirvana
    Illumina DRAGEN RNA Pipeline
    Regenie
    OMOP common data model 5.4
    https://stratus-documentation-us-east-1-public.s3.amazonaws.com/downloads/cohorts/main_vcfmapper.py
    https://crossmap.sourceforge.net/
    https://genome.ucsc.edu/cgi-bin/hgLiftOver
    ftp://ftp.ensembl.org/pub/assembly_mapping/homo_sapiens/

    Git username — This field appears after entering the personal access token and is extracted from your token.

    Main file path (max 255 chars)

    For NextFlow, If the main.nf is not in the root folder, edit the main file path to the main.nf file, otherwise keep main.nf.

    Config file path (max 255 chars)

    When configuring a nextflow pipeline, this is usually nextflow.config and located in the root folder. Edit this field to match your equivalent file and folder.

    Schema file path (max 255 chars)

    When configuring a nextflow pipeline, this is the file which describes the different parameters used by the workflow. This is usually nextflow_schema.json.

    Version

    Use the long commit-id or the tag to identify the version. Platform Core will automatically convert the tag to fill out the commit-id.

    .
  • After import, the pipeline will be in draft status.

  • The details of your pipeline are now visible when opening the pipeline details tab. Here you can change the name and version number, provide a description, update the Nextflow version or edit other details as needed.

  • Proceed to the InputForm files tab to edit the generated inputForm.json file to match the inputs as needed by your pipeline. While you are editing the input form, you can use the simulate button to preview the input form.

  • Once all details are updated, save your pipeline. Analyses with the pipeline can now be executed in the same way as with regular pipelines.

  • GitHub enterprise is not supported.

  • Git-branches are not supported, only tag or commit-id for version control.

  • On GitHub, repository names are limited to 100 characters

  • Repository url (max 255 chars)

    The url where the pipeline is located. For example https://github.com/nf-core/demo Do not use a / as last character of your path as this will result in a failed pipeline with Remote resource not found as error.

    Pipeline name (max 255 chars)

    Name of your pipeline. This is automatically filled out when the repository URL has been validated, but you can change the name.

    Version number

    The version of your pipeline. This is not the same as the tag or commit-id, but used to identify the version of your pipeline to people using it. This field can hold 25 characters.

    Git credential

    Only needed for private repositories. This is your previously configured Git credential. If you need Git credentials, but you have not configured them in the previous step, you can use the create button to configure them now.

    Using Private Repositories

    Git Credentials

    The link to the personal access token on GitHub.com will open a pop-up window, so if it does not open, you might have a pop-up blocker active.

    Personal Access Token

    Creating the pipeline in Platform Core

    To minimise the risk of triggering API-rate limiting on GitHub, the validations above are not performed when configuring pipelines via the API.

    Example

    Restrictions

    https://github.com
    generate
    personal access token
    github.com
    https://github.com/settings/tokens/
    Basic Git-Sourced Pipeline Example
    Github.com
    Connect AWS S3 Bucket to Platform Core Project
  • Uploads all outputs to Platform Core cloud storage

  • The URL presented here will be used later in the container directive for your Nextflow DRAGEN process.

    Creating the pipeline

    Details

    Main.nf

    Input Form

    Running the pipeline

    If you have no test data available, you need to link the Dragen Demo Bundle to your project at Projects > your_project > Project Settings > Details > Linked Bundles.

    Results

    Useful Links

    Nextflow
    pod
    publishDir
    Input Form
    Illumina DRAGEN Documentation
    Official Nextflow documentation

    Otherwise, choose at least standard-large as nf-core pipelines often need more than 4 cores to run.

  • Select the single user workspace permissions (aka "Access limited to workspace owner "), which allows us to deploy pipelines

  • Specify at least 100GB of disk space

  • Optional: After choosing the image, enable a cluster with at least this one standard-largeinstance type

  • Start the workspace, then (if applicable) start the cluster

  • Preparation

    Import nf-core Pipeline to Bench

    A larger example that still runs quickly is nf-core/sarek

    Result

    Run Validation Test in Bench

    The pipeline-dev tool is using "nextflow run ..." to run the pipeline. The full nextflow command is printed on stdout and can be copy-pasted+adjusted if you need additional options.

    Result

    Monitoring

    Data Locations

    Deploy as Flow Pipeline

    Run Validation Test in Flow

    Hints

    Using older versions of Nextflow

    Some older nf-core flows are still using DSL1, which is only working up to Nextflow 22.

    An easy solution is to create a conda environment for nextflow 22:

    Deploy pipeline as an ICA Flow pipeline
    Launch Flow validation test from Bench.
    nextflow.enable.dsl = 2
    
    process DRAGEN {
    
        // The container must be a DRAGEN image that is included in an accepted bundle and will determine the DRAGEN version
        container '079623148045.dkr.ecr.us-east-1.amazonaws.com/cp-prod/7ecddc68-f08b-4b43-99b6-aee3cbb34524:latest'
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'fpga2-medium'
        pod annotation: 'volumes.illumina.com/scratchSize', value: '1TiB'
    
        // ICA will upload everything in the "out" folder to cloud storage 
        publishDir 'out', mode: 'symlink'
    
        input:
            tuple path(read1), path(read2)
            val sample_id
            path ref_tar
    
        output:
            stdout emit: result
            path '*', emit: output
    
        script:
            """
            set -ex
            mkdir -p /scratch/reference
            tar -C /scratch/reference -xf ${ref_tar}
            
            /opt/edico/bin/dragen --partial-reconfig HMM --ignore-version-check true
            /opt/edico/bin/dragen --lic-instance-id-location /opt/instance-identity \\
                --output-directory ./ \\
                -1 ${read1} \\
                -2 ${read2} \\
                --intermediate-results-dir /scratch \\
                --output-file-prefix ${sample_id} \\
                --RGID ${sample_id} \\
                --RGSM ${sample_id} \\
                --ref-dir /scratch/reference \\
                --enable-variant-caller true
            """
    }
    
    workflow {
        DRAGEN(
            Channel.of([file(params.read1), file(params.read2)]),
            Channel.of(params.sample_id),
            Channel.fromPath(params.ref_tar)
        )
    }
    {
      "fields": [
        {
          "id": "read1",
          "label": "FASTQ read 1",
          "type": "data",
          "dataFilter": {
            "dataType": "file",
            "dataFormat": ["FASTQ"]
          },
          "maxValues": 1,
          "minValues": 1
        },
        {
          "id": "read2",
          "label": "FASTQ read 2",
          "type": "data",
          "dataFilter": {
            "dataType": "file",
            "dataFormat": ["FASTQ"]
          },
          "maxValues": 1,
          "minValues": 1
        },
        {
          "id": "ref_tar",
          "label": "Reference TAR",
          "type": "data",
          "dataFilter": {
            "dataType": "file",
            "dataFormat": ["TAR"]
          },
          "maxValues": 1,
          "minValues": 1
        },
        {
            "id": "sample_id",
            "type": "textbox",
            "label": "Sample ID"
          }
      ]
    }
    mkdir demo
    cd demo
    pipeline-dev import-from-nextflow nf-core/demo
    /data/demo $ pipeline-dev import-from-nextflow nf-core/demo
    
    Creating output folder nf-core/demo
    Fetching project nf-core/demo
    
    Fetching project info
    project name: nf-core/demo
    repository  : https://github.com/nf-core/demo
    local path  : /data/.nextflow/assets/nf-core/demo
    main script : main.nf
    description : An nf-core demo pipeline
    author      : Christopher Hakkaart
    
    Pipeline “nf-core/demo” successfully imported into nf-core/demo.
    
    Suggested actions:
      cd nf-core/demo
      pipeline-dev run-in-bench
      [ Iterative dev: Make code changes + re-validate with previous command ]
      pipeline-dev deploy-as-flow-pipeline
      pipeline-dev launch-validation-in-flow
    cd nf-core/demo
    pipeline-dev run-in-bench
    pipeline-dev deploy-as-flow-pipeline
    Choice: 3
    Creating ICA Flow pipeline dev-nf-core-demo_v4
    Sending inputForm.json
    Sending onRender.js
    Sending main.nf
    Sending nextflow.config
    pipeline-dev launch-validation-in-flow
    conda create -n nextflow22
     
    # If, like me, you never ran "conda init", do it now:
    conda init
    bash -l # To load the conda's bashrc changes
     
    conda activate nextflow22
    conda install -y nextflow=22
     
    # Check
    nextflow -version
     
    # Then use the pipeline-dev tools as in the demo
    Refer to the Creating policies on the JSON tab documentation for instructions on creating an AWS IAM Policy via the AWS Management Console. Use the configuration below during the process, tab one shows the code for unversioned buckets, tab two the code for versioned and versioning-suspended buckets.

    Paste the JSON policy document below. Note the example below provides access to all object prefixes in the bucket.

    Replace <YOUR_BUCKET_NAME> with the name of the S3 bucket you created for Platform Core. Replace <YOUR_FOLDER_NAME> with the name of the folder in your S3 bucket.

    {
        "Version": "
    

    On Versioned OR Suspended buckets, paste the JSON policy document below. Note the example below provides access to all objects prefixes in the bucket.

    Replace <YOUR_BUCKET_NAME> with the name of the S3 bucket you created for Platform Core. Replace <YOUR_FOLDER_NAME> with the name of the folder in your S3 bucket.

    {
        "Version": "2012-10-17",
        "Statement": [
            {
                "Effect": "Allow",
                "Action": [
                    "s3:PutBucketNotification",
                    "s3:ListBucket",
                    "s3:GetBucketNotification",
                    "s3:GetBucketLocation",
                    "s3:ListBucketVersions",
                    "s3:GetBucketVersioning"
                ],
                "Resource": [
                    "arn:aws:s3:::<YOUR_BUCKET_NAME>"
                ]
            },
            {
                "Effect": "Allow",
                "Action": [
                    "s3:PutObject",
                    "s3:GetObject",
                    "s3:RestoreObject",
                    "s3:DeleteObject",
                    "s3:DeleteObjectVersion",
                    "s3:GetObjectVersion",
                    "s3:GetObjectTagging",
                    "s3:PutObjectTagging",
                    "s3:GetObjectVersionTagging",
                    "s3:PutObjectVersionTagging"
                ],
                "Resource": "arn:aws:s3:::<YOUR_BUCKET_NAME>/<YOUR_FOLDER_NAME>/*"
            },
            {
                "Effect": "Allow",
                "Action": [
                    "sts:GetFederationToken"
                ],
                "Resource": [
                    "*"
                ]
            }
        ]
    }

    To create the IAM Policy via the AWS CLI, create a local file named illumina-core-admin-policy.json containing the policy content above and run the following command. Be sure the path to the policy document (--policy-document) leads to the path where you saved the file:

    3

    Create AWS IAM User

    An AWS IAM User is needed to create an Access Key for Platform Core to connect to the AWS S3 Bucket. The policy will be attached to the IAM user to grant the user the necessary permissions.

    Refer to the Creating IAM users (console) documentation for instructions on creating an AWS IAM User via the AWS Management Console. Use the following configuration during the process:

    • (optional) Set user name to "illumina_core_admin"

    • Select the Programmatic access option for the type of access.

    • Select Attach existing policies directly when setting the permissions, and choose the policy created in

    • (Optional) Retrieve the Access Key ID and Secret Access Key by choosing to Download .csv.

    To create the IAM user and attach the policy via the AWS CLI, enter the following command (AWS IAM users are global resources and do not require a region to be specified). This command creates an IAM user illumina_core_admin, retrieves your AWS account number, and then attaches the policy to the user.

    4

    Create AWS Access Key

    If the Access Key information was retrieved during the , skip this step.

    Refer to the Managing access keys (console) AWS documentation for instructions on creating an AWS Access Key via the AWS Console. See the "To create, modify, or delete another IAM user's access keys (console)" sub-section.

    Use the command below to create the Access Key for the illumina_core_admin IAM user. Note the SecretAccessKey is sensitive and should be stored securely. The access key is only displayed when this command is executed and cannot be recovered. A new access key must be created if it is lost.

    aws iam create-access-key --user-name illumina_core_admin
    
        "AccessKey": {
            "UserName": "illumina_core_admin",
            "AccessKeyId": "<access key id>",
            "Status": "Active",
            "SecretAccessKey": "<secret access key>",
            "CreateDate": "2020-10-22 09:42:24+00:00"
        }

    The AccessKeyId and SecretAccessKey values will be provided to Platform Core in the next step.

    5

    S3 Bucket Policy

    Connecting your S3 bucket to Platform Core does not require any additional bucket policies.

    What if you need a bucket policy for use cases beyond Platform Core?

    The bucket policy must then support the essential permissions needed by ICA without inadvertently restricting its functionality.

    In this example, restriction is enabled on the bucket policy to prevent any kind of access to the bucket. However, there is an exception rule added for the IAM user that Platform Core is using to connect to the S3 bucket. The exception rule is allowing Platform Core to perform the above S3 action permissions necessary for Platform Core functionalities.

    Additionally, the exception rule is applied to the STS federated user session principal associated with Platform Core. Since Platform Core leverages the AWS STS to provide temporary credentials that allow users to perform actions on the S3 bucket, it is crucial to include these STS federated user session principals in your policy's whitelist. Failing to do so could result in 403 Forbidden errors when users attempt to interact with the bucket's objects using the provided temporary credentials.

    6

    S3 Object Ownership

    Verify that the bucket's Object Ownership is set to ACLs disabled (Bucket owner enforced) on the Permissions tab. This is the AWS-recommended default for new buckets.

    If it is not correctly set, open your bucket In the AWS S3 console, go to the Permissions tab, find Object Ownership, choose Edit, select ACLs disabled (recommended), and save.

    When Illumina copies data into your bucket, the objects are written by an Illumina service identity. If your bucket has ACLs enabled (Bucket owner preferred), those copied objects remain owned by the writer rather than by your bucket, and Illumina's processing is then unable to read them back, which causes copy jobs to stall or fail with an access-denied (403) error. Setting Object Ownership to ACLs disabled (Bucket owner enforced) ensures your account always owns every object in the bucket, so the data can be read and processed normally.

    Object Ownership is not the same as the Bucket Policy

    Object Ownership and Bucket Policy are two separate settings on an S3 bucket:

    • Bucket Policy is the JSON document that grants Illumina access to your bucket.

    7

    Block Public Access to S3 bucket (optional)

    By default, public access to the S3 bucket is allowed. For increased security, it is advised to block public access with the following command below. Change <YOUR_BUCKET_NAME> to the name of your S3 bucket.

    aws s3api put-public-access-block --bucket <YOUR_BUCKET_NAME> --public-access-block-configuration "BlockPublicAcls=true,IgnorePublicAcls=true,BlockPublicPolicy=true,RestrictPublicBuckets=true"

    To block public access to S3 buckets on account level, you can use the AWS Console on the Amazon Web Services website.

    8

    Create Platform Core Storage Credential

    Storage Credential

    To connect your S3 account to Platform Core, you need to add a storage credential in Platform Core containing the Access Key ID and Access Key created in the previous step. From the Platform Core home screen, navigate to System Settings > Credentials > Create > Storage Credential to create a new storage credential.

    Provide a name for the storage credentials, ensure the type is set to "AWS user" and provide the Access Key ID and Secret Access Key.

    The key prefix is mandatory in your storage credentials if you created a folder as recommended in step 2 .

    Storage Configuration

    Once the storage credentials are present, create a storage configuration using the secret credential. Refer to Create a Storage Configuration for details.

    9

    Enabling Cross-Account Access for Copy and Move Operations

    When setting up cross-account access, ensure that no are blocking the required permissions

    Platform Core uses AssumeRole to copy and move objects from a bucket in an AWS account to another bucket in another AWS account. To allow cross account access to a bucket, the following policy statements must be added in the S3 bucket policy.

    Be sure to replace the following fields:

    • <ASSUME_ROLE_ARN>: Replace this field with the ARN of the cross account role you want to give permission to. Refer to the table below to determine which region-specific Role ARN should be used.

      {
            "Version": "
    
      {
            "Version": "2012-10-17",
            "Statement": [
                {
                    "Sid": "AllowCrossAccountAccess",
                    "Effect": "Allow",
                    "Principal": {
                        "AWS": "<ASSUME_ROLE_ARN>"
                    },
                    "Action": [
                        "s3:PutObject",
                        "s3:DeleteObject",
                        "s3:ListMultipartUploadParts",
                        "s3:AbortMultipartUpload",
                        "s3:GetObject",
                        "s3:GetObjectVersion",
                        "s3:DeleteObjectVersion",
                        "s3:GetObjectTagging",
                        "s3:PutObjectTagging",
                        "s3:GetObjectVersionTagging",
                        "s3:PutObjectVersionTagging"
                    ],
                    "Resource": [
                        "arn:aws:s3:::<YOUR_BUCKET_NAME>",
                        "arn:aws:s3:::<YOUR_BUCKET_NAME>/*"
                    ]
                }
            ]
        }

    The ARN of the cross account role you want to give permission to is specified in the Principal. Refer to the table below to determine which region-specific Role ARN should be used.

    Region
    Role ARN

    Before copy and move operations are executed on your own S3 storage, a test is performed to verify the necessary operational rights. This can result in temporary test files remaining (for example when is not correctly set up for a versioned bucket). These files can safely be manually deleted from your S3 console.

    [
        {
            "AllowedHeaders": [
                "*"
            ],
            "AllowedMethods": [
                "HEAD",
                "GET",
                "PUT",
                "POST",
                "DELETE"
            ],
            "AllowedOrigins": [
                "https://ica.illumina.com"
            ],
            "ExposeHeaders": [
                "ETag",
                "x-amz-meta-custom-header"
            ]
        }
    ]

    Configure Bucket CORS Permission

    Create Data Access Permission - AWS IAM Policy

    Permissions

    Copying Object Tags

    burst-new

    Storage configurations created in Platform Core 2.47 or later automatically have object tag copying included.

    For storage configurations created prior to Platform Core v2.47, object tag copying is optional. If you want to enable it, contact Illumina support to enable TaggingPermissionType on the Platform Core Storage Configuration record associated with the S3 bucket with Object tags.

    Object Ownership
    policy statements
    block public access
    here
    Configuring cross-origin resource sharing (CORS)
    IAM Policy
    S3 Bucket policy
    cross-account access bucket policy
    aws iam create-policy --policy-name illumina-core-admin-policy --policy-document file://illumina-core-admin-policy.json

    (Optional) Set policy name to "illumina-core-admin-policy"

    Metadata gives information about a sample and can be provided by the user, the pipeline and the API. There are 2 general categories of metadata models: Project Metadata models and Pipeline Metadata models . Both models contain metadata fields and groups.

    • The project metadata model is specific per tenant. A Project metadata model has metadata linked to a specific project. Values are known upfront, general information is required for each sample of a specific project, and it may include general mandatory company information.

    • The pipeline metadata model is linked to a pipeline, not to a project and can be shared across tenants. Values are populated during pipeline execution and it requires an output file with the name 'metadata.response.json'.

    Each sample can have multiple metadata models. When you link a project metadata model to your project, you will see its groups and fields present on each sample. The root model from that tenant will be present as every metadata model inherits the groups and fields specified in the parent metadata model(s). When a pipeline is executed with single sample and the pipeline containing a metadata model, the groups and fields will be present as well for each analysis resulting from a pipeline execution.

    In the main navigation, go to System Settings > Metadata Models. Here you will see the root metadata model and any underlying sub-metadata models. To create a new submodel, select +Create at the bottom of the screen.

    The new metadata model screen will show an overview of all the higher-level metadata models. use the down arrow next to the model name to expand these for more information.

    For your new metadata model, add a unique name and optional description. Once this is done, start adding the metadata fields with the +Add button. The field type will determine the parameters which you can configure.

    To edit your metadata model later on, select it and choose Manage > Edit. Keep in mind that fields can be added, but not removed once the model is published.

    field types

    Text

    Free text

    Keyword

    Automatically complete value based on already used values

    Numeric

    Only numbers

    The following properties can be selected for groups & fields:

    Propery

    Required

    Pipeline can not be started with this sample until the required group/field is filled in.

    Sensitive

    Values of this group/field are only visible to project users of the own tenant. When a sample is shared across tenants, these fields will not be visible.

    Multi value

    This group/field can consist of multiple (grouped) values

    Newly created and updated metadata models are not available for use within the tenant until the metadata model is published. Once a metadata model is published, fields and field groups cannot be deleted, but the names and descriptions for fields and field groups can be edited. A model can be published after verifying all parent models are published first. To publish your model, select System Settings > Metadata Models > your_metadata_model > Manage > Publish.

    If a published metadata model is no longer needed, you can retire the model (except the root model). Once a model is retired, it can be published again in case you would need to reactivate it.

    1. First, check if the model contains any submodels. A model cannot be retired if it contains any published submodels.

    2. When you are certain you want to retire a model and all submodels are retired, select System Settings > Metadata Models > your_metadata_model > Manage > Retire Metadata Model.

    To add metadata to your samples, you first need to assign a metadata model to your project.

    1. Go to Projects > your_project > Project Settings > Details.

    2. Select Edit.

    3. From the Metadata Model drop-down list, select the metadata model you want to use for the project.

    4. Select Save. All fields configured for the metadata model, and all fields in any parent models are applied to the samples in the project.

    If you have a metadata model assigned to your project, you can manually fill out the defined metadata of the samples in your project:

    1. Go to Projects > your_project > Samples > your_sample.

    2. Click your sample to open the sample details and choose Edit Sample.

    3. Enter all metadata information as it applies to the selected sample. All required metadata fields must be populated or the pipeline will not be able to start.

    4. Select Save

    To fill metadata by pipeline executions, a pipeline model must be created.

    1. In the main navigation, go to Projects > your_project > Flow > Pipelines > your_pipeline.

    2. Click on your pipeline to open the pipeline details and choose Edit.

    3. Create/Edit your model under Metadata Model tab. Field groups should be used when configuring metadata fields that are filled by a pipeline. These fields should be part of the same field group and be configured with the Multiple Value setting enabled.

    In order for your pipeline to fill the metadata model, an output file with the name metadata.response.json must be generated. After adding your group fields to the pipeline model, click on Generate example JSON to view the required format for your pipeline.

    Use System Settings > Metadata Models > your_metadata_model > Manage > Generate example JSON to see an example JSON for these fields.

    Populating metadata models of samples allows having a sample-centric view of all the metadata. It is also possible to synchronize that data into your project's Base warehouse.

    1. In Platform Core, select Projects > your_project >Base > Schedule.

    2. Select +Create > From metadata.

    3. Type a name for your schedule, optionally add a description, and set it to active. You can select if sensitive metadata fields should be included as values of sensitive metadata fields will not be visible to other users outside of the project.

    4. Select Save.

    5. Navigate to Base > Tables in your project.

    6. Two new table schemas should be added with your current metadata models.

    Illumina recommends that you limit the amount of fields or field groups you add to the root model as this model can not be deprecated and anything you add to the root model can not be removed. You should always consider creating submodels before adding anything to the root model.

    Do not use dots (.) in the metadata model names, fieldgroup names or field names as this can cause issues with field data.

    Field groups should be used when configuring metadata fields that are filled by a pipeline. These fields should be part of the same field group and be configured with the Multiple Value setting enabled.

    Creating a Metadata Model

    Field Types & Properties

    Fields cannot be both required and filled by pipeline at the same time.

    To help retrieve the field values via API calls, you can use System Settings > Metadata Models > your_metadata_model > Manage > Show Field Paths.

    Metadata Actions

    Publish a Metadata Model

    Retire a Metadata Model

    Assign a Metadata Model to a Project

    Add Metadata to Samples Manually

    Populating a Pipeline Metadata Model

    The field names cannot have . in them, e.g. for the metric name Q30 bases (excl. dup & clipped bases) the . after excl must be removed.

    Pushing Metadata Metrics to Base

    Field
    Value

    Repository url

    https://github.com/nf-core/demo (Tip: If you encounter Invalid GitHub repository url, you may have copied over a trailing space in the url)

    Pipeline name

    The pipeline name is automatically extracted from the repository. You can manually change this if needed, for example to prevent duplicate names.

    Version number

    Enter the version number. You can choose to use the version number from GitHub (1.1.0) or you can use your own version (for example 1 for being the first local version)

    Storage size

    As this demo pipeline uses very little resources, the smallest size we can select (3XSmall) will be sufficient.

    Git credential

    Method 1 : finding and copying the full commit id
    Method 2 : finding and copying the tag

    As per instructions on the nf-core demo page, create a samplesheet.csv file on your local machine with as contents:

    1. In Platform Core, navigate to Projects > your_project > Data and upload the created samplesheet.csv file to your project.

    If you have the CLI installed on your system, you can use the commands below to upload the samplesheet. If you do not have an active CLI, please follow these instructions first.

    1. List your projects with the command icav2 projects list

    2. From this list of projects, enter your demo project by using icav2 projects enter <your_project_uuid> with your_project_uuid replaced with the uuid of your project.

    3. If you have created the samplesheet.csv file and put it into your CLI directory, you upload it to the root folder of your project with icav2 projectdata upload samplesheet.csv . If this name is already in use, you can rename the file during upload by using icav2 projectdata upload samplesheet.csv /samplesheet2.csv

    With the pipeline configurad and the inputfile created, you are ready to run your analysis.

    1. Go to Projects > your_project > flow > Pipelines.

    2. Select the created pipeline. (The default name will be nf-core/demo) and choose Start analysis at the top of the screen.

    3. You will be presented with the form below.

      • Enter an identifier (user reference) for your pipeline

      • Select the samplesheet.csv file as input and start the analysis.

    You can follow the status of your analysis at Projects > your_project > Flow > Analyses.

    If you have the CLI installed on your system, you can also use the commands below to work with pipelines. If you do not have an active CLI, please follow these instructions first.

    1. List your projects with the command icav2 projects list to retrieve their project uuid.

    2. From this list of projects, enter your demo project by using icav2 projects enter <your_project_uuid> with <your_project_uuid> replaced with the uuid of your project.

    3. To list the pipelines in your project and see their pipeline uuid, use icav2 projectpipelines list

    4. To retrieve the file uuid, use the command icav2 projectdata list --file-name samplesheet.csv . If you used a different name for your samplesheet file, use the name you gave it instead of samplesheet.csv.

    1. To run the pipeline with the input file,

    • Select the pipeline (replace <your_pipeline_uuid> with the uuid of your pipeline).

    • Set the storage size (3XSmall). If this storage is not available in your subscription, you can use icav2 analysisstorages list to get a list of available storage sizes.

    • Set the user reference to give your analysis a name. In this example we use MyDemoGitPipeline as name.

    • Point to the input file (replace <your_file_uuid> with the actual file uuid).

      If you want to see a list of input parameters of your pipeline, use icav2 projectpipelines input <your_pipeline_uuid> this will show you the code of the input parameters. In our example, this is "input"

    The resulting command to run the pipeline is then:

    Even though the import function will have created an input form based on the configured files, you can customise this form to make it easier to use by removing or defaulting parameters.

    1. Go to Projects > your_project > flow > Pipelines > your_pipeline > Edit

    2. Navigate to the Inputform files tab. This will open the inputForm.json file.

    3. Replace the contents with this minimalist input file

    This will result in a minimal input form which only needs the input file selection.

    Demo Pipeline

    The nf-core framework for community-curated bioinformatics pipelines. Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.

    Nat Biotechnol. 2020 Feb 13. doi: 10.1038/s41587-020-0439-x.

    Configuring the Pipeline

    https://github.com/nf-core/demo/
    sample,fastq_1,fastq_2
    SAMPLE1_PE,https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/illumina/amplicon/sample1_R1.fastq.gz,https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/illumina/amplicon/sample1_R2.fastq.gz
    SAMPLE2_PE,https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/illumina/amplicon/sample2_R1.fastq.gz,https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/illumina/amplicon/sample2_R2.fastq.gz
    SAMPLE3_SE,https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/illumina/amplicon/sample1_R1.fastq.gz,
    SAMPLE3_SE,https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/illumina/amplicon/sample2_R1.fastq.gz,
    icav2 projectpipelines start nextflowjson <your_pipeline_uuid> --storage-size 3XSmall --user-reference MyDemoGitPipeline --field-data "input":"<your_file_uuid>"
    {
      "fields": [
        {
          "id": "input",
          "type": "data",
          "label": "input",
          "helpText": "Select your input file",
          },
          "maxValues": 1,
          "minValues": 1
        },
        {
          "id": "outdir",
          "type": "textbox",
          "label": "outdir",
          "helpText": "The output directory where the results will be saved.",
          "hidden": true,
          "value": "out",
          "minValues": 1
        }
      ]
    }

    Creating the Input File

    Using the GUI

    Using the CLI

    Running the Analysis

    Using the GUI

    If your analysis fails with Module path must start with / or ./ prefix -- Offending module: plugin/nf-schema, then the Nextlow version is not set to the latest one. Edit it on your Projects > your_project > flow > Pipelines > your_pipeline > Details

    Using the CLI

    You can search for csv files in your project with the command icav2 projectdata list --file-name csv --match-mode fuzzy.

    Optional : Editing the Input Form

    Tenant-level views
    • ICA_PIPELINE_ANALYSES_VIEW (Lists Platform Core pipeline analysis data)

    • CLARITY_SEQUENCINGRUN_VIEW_tenant (sequencing run data coming from the lab workflow software)

    • CLARITY_SAMPLE_VIEW_tenant (sample data coming from the lab workflow software)

    • CLARITY_LIBRARY_VIEW_tenant (library data coming from the lab workflow software)

    • CLARITY_EVENT_VIEW_tenant (event data coming from the lab workflow software)

    • ICA_DRAGEN_QC_METRIC_ANALYSES_VIEW (quality control metrics)

    • DRAGEN metrics will only have content when DRAGEN pipelines have been executed.

    • Analysis views will only have content when analyses have been executed.

    • Views containing Clarity data will only have content if you have a Clarity LIMS instance with minimum version 6.0 and the Product Analytics service installed and configured. Please see the Clarity LIMS documentation for more information.

    • When you use your storage in a project, metrics can not be collected and thus the DRAGEN METRICS - related views can not be used.

    Members of a project, who have both base contributor and project contributor or administrator rights and who belong to the same tenant as the project can add views from a Catalogue. Members of a project with the same rights who do not belong to the same tenant can remove the catalogue views from a project. Therefore, if you are invited to collaborate on a project, but belong to a different tenant, you can remove catalogue views, but cannot add them again.

    To add Catalogue data,

    1. Go to Projects > your_project > Base > Tables.

    2. Select Add table > Import from Catalogue.

    3. A list of available views will be displayed. (Note that views which are already part of your project are not listed)

    4. Select the table you want to add and choose +Select

    Catalogue data will have View as type, the same as tables which are linked from other projects.

    To delete Catalogue data,

    1. go to Projects > your_project > Base > Tables.

    2. Select the table you want to delete and choose Delete.

    3. A warning will be presented to confirm your choice. Once deleted, you can add the Catalogue data again if needed.

    • View: The name of the Catalogue table.

    • Description: An explanation of which data is contained in the view.

    • Category: The identification of the source system which provided the data.

    • Tenant/project. Appended to the view name as _tenant or _project. Determines if the data is visible for all projects within the same tenant or only within the project. Only the tenant administrator can see the non-project views.

    In the Projects > your_project > Base > Tables view, double-click the Catalogue table to see the details. For an overview of the available actions and details, see Tables.

    In this section, we provide examples of querying selected views from the Base UI, starting with ICA_PIPELINE_ANALYSES_VIEW (project view). This table includes the following columns: TENANT_UUID, TENANT_ID, TENANT_NAME, PROJECT_UUID, PROJECT_ID, PROJECT_NAME, USER_UUID, USER_NAME, and PIPELINE_ANALYSIS_DATA. While the first eight columns contain straightforward data types (each holding a single value), the PIPELINE_ANALYSIS_DATA column is of type VARIANT, which can store multiple values in a nested structure. In SQL queries, this column returns data as a JSON object. To filter specific entries within this complex data structure, a combination of JSON functions and conditional logic in SQL queries is essential.

    Since Snowflake offers robust JSON processing capabilities, the FLATTEN function can be utilized to expand JSON arrays within the PIPELINE_ANALYSIS_DATA column, allowing for the filtering of entries based on specific criteria. It's important to note that each entry in the JSON array becomes a separate row once flattened. Snowflake aligns fields outside of this FLATTEN operation accordingly, i.e. the record USER_ID in the SQL query below is "recycled".

    The following query extracts

    • USER_NAME directly from the ICA_PIPELINE_ANALYSES_VIEW_project table.

    • PIPELINE_ANALYSIS_DATA:reference and PIPELINE_ANALYSIS_DATA:price. These are direct accesses into the JSON object stored in the PIPELINE_ANALYSIS_DATA column. They extract specific values from the JSON object.

    • Entries from the array 'steps' in the JSON object. The query uses LATERAL FLATTEN(input => PIPELINE_ANALYSIS_DATA:steps) to expand the steps array within the PIPELINE_ANALYSIS_DATA JSON object into individual rows. For each of these rows, it selects various elements (like bpeResourceLifeCycle, bpeResourcePresetSize, etc.) from the JSON.

    Furthermore, the query filters the rows based on the status being 'FAILED' and the stepId not containing the word 'Workflow': it allows the user to find steps which failed.

    Now let's have a look at DRAGEN_METRICS_VIEW_project view. Each DRAGEN pipeline on Platform Core creates multiple metrics files, e.g. SAMPLE.mapping_metrics.csv, SAMPLE.wgs_coverage_metrics.csv, etc for DRAGEN WGS Germline pipeline. Each of these files is represented by a row in DRAGEN_METRICS_VIEW_project table with columns ANALYSIS_ID, ANALYSIS_UUID, PIPELINE_ID, PIPELINE_UUID, PIPELINE_NAME, TENANT_ID, TENANT_UUID, TENANT_NAME, PROJECT_ID, PROJECT_UUID, PROJECT_NAME, FOLDER, FILE_NAME, METADATA, and ANALYSIS_DATA. ANALYSIS_DATA column contains the content of the file FILE_NAME as an array of JSON objects. Similarly to the previous query we will use FLATTEN command. The following query extracts

    • Sample name from the file names.

    • Two metrics 'Aligned bases in genome' and 'Aligned bases' for each sample and the corresponding values.

    The query looks for files SAMPLE.wgs_coverage_metrics.csv only and sorts based on the sample name:

    Lastly, you can combine these views (or rather intermediate results derived from these views) using the WITH and JOIN commands. The SQL snippet below demonstrates how to join two intermediate results referred to as 'flattened_dragen_scrna' and 'pipeline_table'. The query:

    • Selects two metrics ('Invalid barcode read' and 'Passing cells') associated with single-cell RNA analysis from records where the FILE_NAME ends with 'scRNA.metrics.csv', and then stores these metrics in a temporary table named 'flattened_dragen_scrna'.

    • Retrieves metadata related to all scRNA analyses by filtering on the pipeline ID from the 'ICA_PIPELINE_ANALYSES_VIEW_project' view and stores this information in another temporary table named 'pipeline_table'.

    • Joins the two temporary tables using the JOIN operator, specifying the join condition with the ON operator.

    You can use ICA_PIPELINE_ANALYSES_VIEW to obtained the costs of individual steps of an analysis. Using the following SQL snippet you can retrieve the costs of individual steps for every analyses run in the past week.

    • Data Catalogue views cannot be shared as part of a Bundle.

    • Data size is not shown for views because views are a subset of data.

    • By removing Base from a project, the Data Catalogue will also be removed from that project.

    As tenant-level Catalogue views can contain sensitive data, it is best to save this (filtered) data to a new table and share that table instead of sharing the entire view as part of a project. To do so, add your view to a separate project and run a query on the data at Projects > your_project > Base > Query > New Query. When the query completes, you can export the result as a new table. This ensures no new data will be added on consequent runs.

    Available views

    SELECT
        USER_NAME as user_name,
        PIPELINE_ANALYSIS_DATA:reference as reference,
        PIPELINE_ANALYSIS_DATA:price as price,
        PIPELINE_ANALYSIS_DATA:totalDurationInSeconds as duration,
        f.value:bpeResourceLifeCycle::STRING as bpeResourceLifeCycle,
        f.value:bpeResourcePresetSize::STRING as bpeResourcePresetSize,
        f.value:bpeResourceType::STRING as bpeResourceType,
        f.value:completionTime::TIMESTAMP as completionTime,
        f.value:durationInSeconds::INT as durationInSeconds,
        f.value:price::FLOAT as price,
        f.value:pricePerSecond::FLOAT as pricePerSecond,
        f.value:startTime::TIMESTAMP as startTime,
        f.value:status::STRING as status,
        f.value:stepId::STRING as stepId
    FROM
        ICA_PIPELINE_ANALYSES_VIEW_project,
        LATERAL FLATTEN(input => PIPELINE_ANALYSIS_DATA:steps) f
    WHERE
        f.value:status::STRING = 'FAILED'
        AND f.value:stepId::STRING NOT LIKE '%Workflow%';
    SELECT DISTINCT
        SPLIT_PART(FILE_NAME, '.wgs_coverage_metrics.csv', 1) as sample_name,
        f.value:column_2::STRING as metric,
        f.value:column_3::FLOAT as value
    FROM
        DRAGEN_METRICS_VIEW_project,
        LATERAL FLATTEN(input => ANALYSIS_DATA) f
    WHERE
        FILE_NAME LIKE '%wgs_coverage_metrics.csv'
        AND (
            f.value:column_2::STRING = 'Aligned bases in genome'
            OR f.value:column_2::STRING = 'Aligned bases'
        )
    ORDER BY
        sample_name;
    WITH flattened_dragen_scrna AS (   
    SELECT DISTINCT
        SPLIT_PART(FILE_NAME, '.scRNA.metrics.csv', 1) as sample_name,
        ANALYSIS_UUID, 
        f.value:column_2::STRING as metric,
        f.value:column_3::FLOAT as value
    FROM
        DRAGEN_METRICS_VIEW_project,
        LATERAL FLATTEN(input => ANALYSIS_DATA) f
    WHERE
        FILE_NAME LIKE '%scRNA.metrics.csv'
        AND (
            f.value:column_2::STRING = 'Invalid barcode read'
            OR f.value:column_2::STRING = 'Passing cells'
        )
    ),
    pipeline_table AS (
    SELECT
        PIPELINE_ANALYSIS_DATA:reference::STRING as reference,
        PIPELINE_ANALYSIS_DATA:id::STRING as analysis_id,
        PIPELINE_ANALYSIS_DATA:status::STRING as status,
        PIPELINE_ANALYSIS_DATA:pipelineId::STRING as pipeline_id,
        PIPELINE_ANALYSIS_DATA:requestTime::TIMESTAMP as start_time
    FROM
        ICA_PIPELINE_ANALYSES_VIEW_project
    WHERE
        PIPELINE_ANALYSIS_DATA:pipelineId = 'c9c9a2cc-3a14-4d32-b39a-1570c39ebc30'
        )
    SELECT * FROM flattened_dragen_scrna JOIN pipeline_table 
    ON
         flattened_dragen_scrna.ANALYSIS_UUID = pipeline_table.analysis_id;
    SELECT
        USER_NAME as user_name,
        PROJECT_NAME as project,
        SUBSTRING(PIPELINE_ANALYSIS_DATA:reference, 1, 30) as reference,
        PIPELINE_ANALYSIS_DATA:status as status,
        ROUND(PIPELINE_ANALYSIS_DATA:computePrice,2) as price,
        PIPELINE_ANALYSIS_DATA:totalDurationInSeconds as duration,
        PIPELINE_ANALYSIS_DATA:startTime::TIMESTAMP as startAnalysis,
        f.value:bpeResourceLifeCycle::STRING as bpeResourceLifeCycle,
        f.value:bpeResourcePresetSize::STRING as bpeResourcePresetSize,
        f.value:bpeResourceType::STRING as bpeResourceType,
        f.value:durationInSeconds::INT as durationInSeconds,
        f.value:price::FLOAT as priceStep,
        f.value:status::STRING as status,
        f.value:stepId::STRING as stepId
    FROM
        ICA_PIPELINE_ANALYSES_VIEW_project,
        LATERAL FLATTEN(input => PIPELINE_ANALYSIS_DATA:steps) f
    WHERE
       PIPELINE_ANALYSIS_DATA:startTime > CURRENT_TIMESTAMP() - INTERVAL '1 WEEK'
    ORDER BY
       priceStep DESC;

    Preconditions for view content

    Who can add or remove Catalogue data (views) to a project?

    Adding Catalogue data (views) to your project

    Removing Catalogue data (views) from your project

    Catalogue table details (Catalogue Table Selection Screen)

    Catalogue table details (Table Schema Definition)

    Querying views

    An example how to obtain the costs incurred by the individual steps of an analysis

    Limitations

    Best Practices

    All available tables are listed on the Run tab.

    Queries are executed using SQL (for example Select * From table_name). When there is a syntax issue with the query, the error will be displayed on the query screen when trying to run it. The query can be immediately executed or saved for future use.

    • When you have duplicate column names in your query, put the columns explicitly in the select clause and use column aliases for columns with the same name.

    • Case sensitive column names (such as the VARIANTS table) must be surrounded by double quotes. For example, select * from MY_TABLE where "PROJECT_NAME" = 'MyProject'.

    • The syntax for Platform Core case-sensitive subfields is without quotes, for example select * from MY_TABLE where ica:Tenant = 'MyTenant' As these are case sensitive, the upper and lowercasing must be respected.

    • If you want to query data from a table shared from another tenant (indicated in green), select the table (Projects > your_project > Base > Tables > your_table) to see the unique name. In the example below, the query will be select * from demo_alpha_8298.public.TestFiles

    • For more information on queries, please also see the snowflake documentation: https://docs.snowflake.com/en/user-guide/

    Some tables contain columns with an array of values instead of a single value.

    Suppose you have a table called YOUR_TABLE_NAME consisting of three fields. The first is a name, the second is a code and the third field is an array of data called ArrayField:

    NameField
    CodeField
    ArrayField

    Name A

    Code A

    { “userEmail”: “email_A@server.com”, "bundleName": null, “boolean”: false }

    Name B

    Code B

    { “userEmail”: “email_B@server.com”, "bundleName": "thisbundle", “boolean”: true }

    Examples

    You can use the name field and code field to do queries by running

    Select * from YOUR_TABLE_NAME where NameField = "Name A".

    If you want to show specific data like the email and bundle name from the array, this becomes

    Select ArrayField:userEmail as User_Email, ArrayField:bundleName as Bundle_Name from YOUR_TABLE_NAME where NameField = "Name A".

    If you want to use data in the array as your selection criteria, the expression becomes

    If the query is valid for execution, the result will be shown as a table underneath the input box. Only the first 200 chars of a string, record or variant field are included in the query results grid. The complete value is available through clicking the "show details" link.

    From within the result page of the query, it is possible to save the result in several ways:

    • Export to > New table saves the query result as a new table with contents.

    • Export to > New view saves the query results as a new view.

    • Export to > Project file: As a new table, as a view or as file to the project in CSV (Tab, Pipe or a custom delimeter is also allowed.) or JSON format. When exporting in JSON format, the result will be saved in a text file that contains a JSON object for each entry, similar to when exporting a table. The exported file can be located in the Data page under the folder named base_export_<user_supplied_name>_<auto generated unique id>.

    1. Navigate to Projects > your_project > Base > Query.

    2. Enter the query to execute using SQL.

    3. Select Run.

    4. Optionally, select Save to add the query to your saved queries list.

    If the query takes more than 30 seconds without returning a result, a message will be displayed to inform you the query is still in progress and the status can be consulted on Projects > your_project > Activity > Base Jobs. Once this Query is successfully completed, the results can be found in Projects > your_project > Base > Query > Query History tab.

    The query history lists all queries that were executed. Historical queries are shown with their date, executing user, returned rows and duration of the run.

    1. Navigate to Projects > your_project > Base > Query.

    2. Select the History tab.

    3. Select a query.

    4. Perform one of the following actions:

      • Use—Open the query for editing and running in the Run tab. You can then select Run to execute the query again.

      • Save —Save the query to the saved queries list.

      • View Results—Download the results from a query or export results to a new table, view, or file in the project. Results are available for 24 hours after the query is executed. To view results after 24 hours, you need to execute the query again.

    All queries saved within the project are listed under the Saved tab together with the query templates.

    The saved queries can be:

    • Use — Open the query for editing and running in the Run tab. You can then select Run to execute the query again.

    • Saved as template — The saved query becomes a query template.

    • Deleted — The query is removed from the list and cannot be opened again.

    The query templates can be:

    • Opened: This will open the query again in the “New query” tab.

    • Deleted: The query is removed from the list and cannot be opened again.

    It is possible to edit the saved queries and templates by double-clicking on each query or template. Specifically for Query Templates, the data classification can be edited to be:

    • Account: The query template will be available for everyone within the account

    • User: The query template will be available for the user who created it

    If you have saved a query, you can run the query again by selecting it from the list of saved queries.

    1. Navigate to Projects > your_project > Base > Query.

    2. Select the Saved Queries tab.

    3. Select a query.

    4. Select Open Query to open the query in the New Query tab from where it can be edited if needed and run by selecting Run Query.

    Shared databases are displayed under the list of Tables as Shared Database for project <project name>.

    New Query

    Available tables

    Metadata tables are created by syncing with the Base module. This synchronization is configured on the Details page within the project.

    Input

    Best practices and notes

    Do not use queries such as ALTER TABLE to modify your table structure as it will go out of sync with the table definition and will result in processing errors.

    Querying data within columns.

    Querying data within an array

    As of Platform Core version 2.27, there is a change in the use of capitals for Platform Core array fields. In previous versions, the data name within the array would start with a capital letter. As of 2.27, lowercase is used. For example ICA:Data_reference has become ICA:data_reference.

    You can use the GET_IGNORE_CASE option to adapt existing queries when you have both data in the old syntax and new data in the lowercase syntax. The syntax is GET_IGNORE_CASE(Table_Name.Column_Name,'Array_field')

    For example:

    Query results

    Run a new query

    Query history

    Saved Queries

    Run a saved Query

    Shared database for project

    For Platform Core Cohorts customers, shared databases are available in a project Base instance. For more information on specific Cohorts shared database tables that are viewable, See .

    Sample:
    • Sample type such as FFPE.

    • Tissue type.

    • Sequencing technology: Whole genome DNA-sequencing, RNAseq, single-cell RNAseq, etc.

  • Subject:

    • Subject inclusion by Identifier:

      • Input a list of Subject Identifiers (up to 100 entries) when defining a cohort.

      • The Subject Identifier filter is combined using AND logic with any other applied filters.

      • Within the list of subject identifiers, OR logic is applied (i.e., a subject matches if it is in the provided list).

    • Demographics such as age, sex, ancestry.

    • Biometrics such as body height, body mass index.

    • Family and patient medical history.

  • Sample:

    • Sample type such as FFPE.

    • Tissue type.

    • Sequencing technology: Whole genome DNA-sequencing, RNAseq, single-cell RNAseq, etc.

  • Disease:

    • Phenotypes and diseases from standardized ontologies.

  • Drug:

    • Drugs from standardized ontologies along with specific typing, stop reasons, drug administration routes, and time points.

  • Molecular attributes:

    • Samples with a somatic mutation in one or multiple, specified genes.

    • Samples with a germline variant of a specific type in one or multiple, specified genes.

    • Samples over- or under-expressed in one or multiple, specified genes.

    • Samples with a copy number gain or loss involving one or multiple, specified genes.

  • Platform Core Cohorts currently uses six standard medical ontologies to 1) annotate each subject during ingestion and then to 2) search for subjects: HPO for phenotypes, MeSH, SNOMED-CT, ICD9-CM, ICD10-CM, and OMIM for diseases. By default, any type-ahead search will find matches from all six, and you can limit the search to only the ones you prefer. When searching for subjects using names or codes from one of these ontologies, Platform Core Cohorts will automatically match your query against all the other ontologies, therefore returning subjects that have been ingested using a corresponding entry from another ontology.

    In the Disease tab, you can search for subjects diagnosed with one or multiple diseases, as well as phenotypes, in two ways:

    • Start typing the English name of a disease/phenotype and pick from the suggested matches. Continue typing if your disease/phenotype of interest is not listed initially.

      • Use the mouse to select the term or navigate to the term in the dropdown using the arrow buttons.

      • If applicable, the concept hierarchy is shown, with ancestors and immediate children visible.

      • For diagnostic hierarchies, concept children count and descendant count for each disease name is displayed.

        • Descendant Count: Displays next to each disease name in the tree hierarchy (e.g., "Disease (10)").

        • Leaf Nodes: No children count shown for leaf nodes.

        • Missing Counts: Children count is hidden if unavailable.

      • Select a checkbox to include the diagnostic term along with all of its children and decedents.

      • Expand the categories and select or deselect specific disease concepts.

    • Paste one or multiple diagnostic codes separated by a pipe (‘|’).

    In the Drug tab, you can search for subjects who have a specific medication record:

    • Start typing the concept name for the drug and pick from suggested matches. Continue typing if the drug is not listed initially.

    • Paste one or multiple drug concept codes. Platform Core Cohorts currently uses RXNorm as a standard ontology during ingestion. If multiple concepts are in your instance of Platform Core Cohorts, they will be listed under Concept Ontology.

    • 'Drug Type' is a static list of qualifiers that denote the specific administration of the drug. For example, where the drug was dispensed.

    • 'Stop Reason' is a static list of attributes describing a reason why a drug was stopped if available in the data ingestion.

    • 'Drug Route' is a static list of attributes that describe the physical route of administration of the drug. For example, Intravenous Route (IV).

    In the ‘Measurements’ tab, you can search for vital signs and laboratory test data leveraging LOINC concept codes. ·

    • Start typing the English name of the LOINC term, for example, ‘Body height’. A dropdown will appear with matching terms. Use the mouse or down arrows to select the term.

    • Upon selecting a term, the term will be available for use in a query.

    • Terms can be added to your query criteria.

    • For each term, you can set a value Greater than or equal, Equals, Less than or equal, In range, or Any value.

    • Any value will find any record where there is an entry for the measurement independent of an available value.

    • Click Apply to add your criteria to the query.

    • Click Update Now to update the running count of the Cohort.Include/Exclude

    • As attributes are added to the 'Selected Condition' on the right-navigation panel, you can choose to include or exclude the criteria selected.

      • Select a criterion from 'Subject', 'Disease', and/or 'Molecular' attributes by filling in the appropriate checkbox on the respective attribute selection pages.

      • When selected, the attribute will appear in the right-navigation panel.

      • You can use the 'Include' / 'Exclude' dropdown next to the selected attribute to decide if you want to include or exclude subjects and samples matching the attribute.

    Once you selected Create Cohort, the above data are organized in tabs such as Project, Subject, Disease, and Molecular. Each tab then contains the aforementioned sections, among others, to help you identify cases and/or controls for further analysis. Navigate through these tabs, or search for an attribute by name to directly jump to that tab and section, and select attributes and values that are relevant to describe your subjects and samples of interest. Assign a new name to the cohort you created, and click Apply to save the cohort.

    • After creating a Cohort, select the Duplicate icon.

    • A copy of the Cohort definition will be created and tagged with "_copy".

    • Deleting a Cohort Definition can be accomplished by clicking the Delete Cohort icon.

    • This action cannot be undone.

    After creating a Cohort, users can set a Cohort bookmark as Shared. By sharing a Cohort, the Cohort will be available to be applied across the project by other users with access to the Project. Cohorts created in a Project are only accessible at scope of the user. Other users in the project cannot see the cohort created unless they use this sharing functionality.

    • Create a Cohort using the directions above.

    • To make the Cohort available to other users in your Project, click the Share icon.

    • The Share icon will be filled in black and the Shared Status will be turned from Private to Shared.

    • Other users with access to Cohorts in the Project can now apply the Cohort bookmark to their data in the project.

    • To unshare the Cohort, click the Share icon.

    • The icon will turn from black to white, and other users within the project will no longer have access to this cohort definition.

    • A Shared Cohort can be Archived.

    • Select a Shared Cohort with a black Shared Cohort icon.

    • Click the Archive Cohort icon.

    • You will be asked to confirm this selection.

    • Upon archiving the Cohort definition, the Cohort will no longer be seen by other users in the Project.

    • The archived Cohort definition can be unarchived by clicking the Unarchive Cohort icon.

    • When the Cohort definition is unarchived, it will be visible to all users in the Project.

    You can link cohorts data sets to a bundle as follows:

    • Create or edit a bundle at Bundles from the main navigation.

    • Navigate to Bundles > your_bundle > Cohorts > Data Sets.

    • Select Link Data Set to Bundle.

    • Select the data set which you want to link and +Select.

    • After a brief time, the cohorts data set will be linked to your bundle and ICA_BASE_100 will be logged.

    You can unlink cohorts data sets from bundles as follows:

    • Edit the desired bundle at Bundles from the main navigation.

    • Navigate to Bundles > your_bundle > Cohorts > Data Sets.

    • Select the cohorts data set which you want to unlink.

    • Select Unlink Data Set from Bundle.

    • After a brief time, the cohorts data set will be unlinked from your bundle and ICA_BASE_101 will be logged.

    Disease search

    Drug Search

    Measurement Search

    Include/Exclude

    The semantics of 'Include' work in such a way that a subject needs to match only one or multiple of the 'included' attributes in any given category to be included in the cohort. (Category refers to disease, sex, body height, etc.) For example, if you specify multiple diseases as inclusion criteria, subjects will only need to be diagnosed with one of them. Using 'Exclude', you can exclude any subject who matches one or multiple exclusion criteria; subjects do not have to match all exclusion criteria in the same category to be excluded from the cohort.

    This feature is not available on the 'Project' level selections as there is no overlap between subjects in datasets.

    Using exclusion criteria does not account for NULL values. For example, if the Super-population 'Europeans' is excluded, subjects will be in your cohort even if they do not contain this data point.

    Duplicate a Cohort Definition

    Delete a Cohort Definition

    Sharing a Cohort within a Platform Core Project

    Share Cohort Definition

    Unshare a Cohort Definition

    Archive a Cohort Definition

    Sharing a Cohort as Bundle

    If you can not find the cohorts data sets which you want to link, verify if

    • Your data set is part of a project (Projects > your_project > Cohorts > Data Sets)

    • This project is set to Data Sharing (Projects > your_project > Project Settings > Details)

    Stop sharing a Cohort as Bundle

    radio

    A radio button group to select one from a list of choices. The values to choose from must be unique.

    select

    A dropdown selection to select one from a list of choices. This can be used for both single-level lists and tree-based lists.

    number

    The value is of Number type in javascript and Double type in java. (corresponds to doubleType in xml).

    integer

    Corresponds to java Integer.

    data

    Data such as files.

    section

    For splitting up fields, to give structure. Rendered as subtitles. No values are to be assigned to these fields.

    text

    To display informational messages. No values are to be assigned to these fields.

    fieldgroup

    Can contain parameters or other groups. Allows to have repeating sets of parameters, for instance when a father|mother|child choice needs to be linked to each file input. So if you want to have the same elements multiple times in your form, combine them into a fieldgroup. Does not support the emptyValuesAllowed attribute.

    These attributes can be used to configure all parameter types.

    Attribute
    Purpose

    label

    The display label for this parameter. Optional but recommended, id will be used if missing.

    minValues

    The minimal amount of values that needs to be present. Default when not set is 0. Set to >=1 to make the field required.

    maxValues

    The maximal amount of values that need to be present. Default when not set is 1.

    Feature

    Streamable inputs

    Adding "streamable":true to an input field of type "data" makes it a streamable input.

    textbox

    Corresponds to stringType in xml.

    checkbox

    inputForm.json

    The inputForm.json file has a size limit of 10 MB and a maximum of 200 fields.

    Parameter types

    inputForm.json

    A checkbox that supports the option of being required, so can serve as an active consent feature. (corresponds to the booleanType in xml).

    Parameter Attributes

    Tree structure example

    "choices" can be used for a single list or for a tree-structured list. See below for an example for how to set up a tree structure.

    Experimental Features

    quantification
  • FastQC

  • MultiQC

  • We will also upload a Docker container to the Platform Core Docker repository for use within the pipeline.

    The 'main.nf' file defines the pipeline that orchestrates various RNASeq analysis processes.

    The script uses the following tools:

    • Salmon: Software tool for quantification of transcript abundance from RNA-seq data.

    • FastQC: QC tool for sequencing data

    • MultiQC: Tool to aggregate and summarize QC reports

    We need a Docker container containing these tools. For the sake of this tutorial, we will use the container from the original tutorial. You can refer to the "Build and push your own Docker image to Platform Core" section to build your own docker image with the required tools.

    With Docker installed in your computer, download the image required for this project using the following command.

    docker pull nextflow/rnaseq-nf

    Create a tarball of the image to upload to Platform Core.

    Following are lists of commands that you can use to upload the tarball to your project.

    Add the image to the Platform Core Docker repository

    The uploaded image can be added to the Platform Core Docker repository from the graphical user interface.

    Change the format for the image tarball to DOCKER:

    1. Navigate to Projects > your_project > Data.

    2. Check the checkbox for the uploaded tarball.

    3. Click on Manage > Change format.

    4. In the new popup window, select "DOCKER" format and save.

    To add this image to the Platform Core Docker repository, first click on Projects to go back to the home page.

    1. From the Platform Core home page, click on System Settings > Docker Repository > Create > Image.

    2. This will open a new window that lets you select the region (US, EU, CA) in which your your project is and the docker image from the bottom pane.

    3. Edit the Name field to rename it. For this tutorial, we will change the name to "rnaseq". Select the region, and give it a version number, and description. Click on "Save".

    After creating a new docker image, you can click on the image to get the container URL (under Regions) for the nextflow configuration file.

    Create a configuration file called "nextflow.config" in the same folder as the main.nf file above. Use the URL copied above to add the process.container line in the config file.

    You can add a pod directive within a process or in the config file to specify a compute type. The following is an example of a configuration file with the 'standard-small' compute type for all processes. Please refer to the Compute Types page for a list of available compute types.

    The parameters file defines the pipeline input parameters. Refer to the JSON or XML input for detailed information for creating correctly formatted parameters files.

    An empty form looks as follows:

    The input files are specified within a single dataInputs node with individual input file specified in a separate dataInput node. Settings (as opposed to files) are specified within the steps node. Settings represent any non-file input to the pipeline, including but not limited to, strings, booleans, integers, etc..

    For this tutorial, we do not have any settings parameters but it requires multiple file inputs. The parameters.xml file looks as follows:

    Use the following commands to create the pipeline with the above contents in your project.

    If not already in the project context, enter it by using the following command:

    icav2 enter <PROJECT NAME or ID>

    Create pipeline using icav2 project pipelines create nextflow Example:

    If you prefer to organize the processes in different folders/files, you can use --other parameter to upload the different processes as additional files. Example:

    You can refer to page to explore options to automate this process.

    Refer to for details on running the pipeline from CLI.

    Example command to run the pipeline from CLI:

    You can get the pipeline id under "ID" column by running the following command:

    You can get the file ids under "ID" column by running the following commands:

    Please refer to command help (icav2 [command] --help) to determine available flags to filter output of above commands if necessary. You can also refer to Command Index page for available flags for the icav2 commands.

    For more help on uploading data to Platform Core, please refer to the Data Transfer options page.

    Nextflow CLI

    Installation

    Tutorial project

    these instructions
    Authentication
    Simple RNA-Seq
    nextflow.enable.dsl = 2
    
    process INDEX {
       input:
           path transcriptome_file
    
       output:
           path 'salmon_index'
    
       script:
           """
           salmon index -t $transcriptome_file -i salmon_index
           """
    }
    
    process QUANTIFICATION {
       publishDir 'out', mode: 'symlink'
    
       input:
           path salmon_index
           tuple path(read1), path(read2)
           val(quant)
    
       output:
           path "$quant"
    
       script:
           """
           salmon quant --libType=U -i $salmon_index -1 $read1 -2 $read2 -o $quant
           """
    }
    
    process FASTQC {
    
       input:
           tuple path(read1), path(read2)
    
       output:
           path "fastqc_logs"
    
       script:
           """
           mkdir fastqc_logs
           fastqc -o fastqc_logs -f fastq -q ${read1} ${read2}
           """
    }
    
    process MULTIQC {
       publishDir 'out', mode:'symlink'
    
       input:
           path '*'
    
       output:
           path 'multiqc_report.html'
    
       script:
           """
           multiqc .
           """
    }
    
    workflow {
       index_ch = INDEX(Channel.fromPath(params.transcriptome_file))
       quant_ch = QUANTIFICATION(index_ch, Channel.of([file(params.read1), file(params.read2)]),Channel.of("quant"))
       fastqc_ch = FASTQC(Channel.of([file(params.read1), file(params.read2)]))
       MULTIQC(quant_ch.mix(fastqc_ch).collect())
    }
    docker save nextflow/rnaseq-nf > cont_rnaseq.tar
    # Enter the project context
    icav2 enter docs
    # Upload the container image to the root directory (/) of the project
    icav2 projectdata upload cont_rnaseq.tar /
    process.container = '079623148045.dkr.ecr.us-east-1.amazonaws.com/cp-prod/3cddfc3d-2431-4a85-82bb-dae061f7b65d:latest'
    process {
        container = '079623148045.dkr.ecr.us-east-1.amazonaws.com/cp-prod/3cddfc3d-2431-4a85-82bb-dae061f7b65d:latest'
        pod = [
            annotation: 'scheduler.illumina.com/presetSize',
            value: 'standard-small'
        ]  
    }
    <pipeline code="" version="1.0" xmlns="xsd://www.illumina.com/ica/cp/pipelinedefinition">
       <dataInputs>
       </dataInputs>
       <steps>
       </steps>
    </pipeline>
    <?xml version="1.0" encoding="UTF-8" standalone="yes"?>
    <pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition" code="" version="1.0">
       <pd:dataInputs>
           <pd:dataInput code="read1" format="FASTQ" type="FILE" required="true" multiValue="false">
               <pd:label>FASTQ Read 1</pd:label>
               <pd:description>FASTQ Read 1</pd:description>
           </pd:dataInput>
           <pd:dataInput code="read2" format="FASTQ" type="FILE" required="true" multiValue="false">
               <pd:label>FASTQ Read 2</pd:label>
               <pd:description>FASTQ Read 2</pd:description>
           </pd:dataInput>
           <pd:dataInput code="transcriptome_file" format="FASTA" type="FILE" required="true" multiValue="false">
               <pd:label>Transcript</pd:label>
               <pd:description>Transcript faster</pd:description>
           </pd:dataInput>
       </pd:dataInputs>
       <pd:steps/>
    </pd:pipeline>
    icav2 projectpipelines create nextflow rnaseq-docs --main main.nf --parameter parameters.xml --config nextflow.config --storage-size small --description 'cli nextflow pipeline'
    icav2 projectpipelines create nextflow rnaseq-docs --main main.nf --parameter parameters.xml --config nextflow.config --other index.nf:filename=processes/index.nf --other quantification.nf:filename=processes/quantification.nf --other fastqc.nf:filename=processes/fastqc.nf --other multiqc.nf:filename=processes/multiqc.nf --storage-size small --description 'cli nextflow pipeline'
    icav2 projectpipelines start nextflow <pipeline_id> --input read1:<read1_file_id> --input read2:<read2_file_id> --input transcriptome_file:<transcriptome_file_id> --storage-size small --user-reference demo_run
    icav2 projectpipelines list
    icav2 projectdata list

    main.nf

    Docker image upload

    If you have the images hosted in other repositories, you can add them as external image by using System Settings > Docker Repository > Create > External Image.

    Nextflow configuration file

    Parameters file

    In the step Create AWS IAM Policy (IAM User) or Create AWS IAM Policy (IAM Role) update the following:
    • Add permission to use KMS key by adding kms:Decrypt, kms:Encrypt, and kms:GenerateDataKey

    • Add the ARN KMS key arn:aws:kms:xxx on the first "Resource"

    • Depending on the bucket type (Unversioned, Versioned or Suspended) the permissions must match the following.

    {
        "Version": "2012-10-17",
        "Statement": [
            {
                "Effect": "Allow",
                "Action": [
                    "kms:Decrypt",
                    "kms:Encrypt",
                    "kms:GenerateDataKey",
                    "s3:PutBucketNotification",
                    "s3:ListBucket",
                    "s3:GetBucketNotification",
                    "s3:GetBucketLocation"
                ],
                "Resource": [
                    "arn:aws:kms:xxx",
                    "arn:aws:s3:::YOUR_BUCKET_NAME"
                ]
            },
            {
                "Effect": "Allow",
                "Action": [
                    "s3:PutObject",
                    "s3:GetObject",
                    "s3:RestoreObject",
                    "s3:DeleteObject",
                    "s3:GetObjectTagging",
                    "s3:PutObjectTagging"
                ],
                "Resource": "arn:aws:s3:::YOUR_BUCKET_NAME/YOUR_FOLDER_NAME/*"
            },
            {
                "Effect": "Allow",
                "Action": [
                    "sts:GetFederationToken"
                ],
                "Resource": [
                    "*"
                ]
            }
        ]
    }
    {
        "Version": "2012-10-17",
        "Statement": [
            {
                "Effect": "Allow",
                "Action": [
                    "kms:Decrypt",
                    "kms:Encrypt",
                    "kms:GenerateDataKey",
                    "s3:PutBucketNotification",
                    "s3:ListBucket",
                    "s3:GetBucketNotification",
                    "s3:GetBucketLocation",
                    "s3:ListBucketVersions",
                    "s3:GetBucketVersioning"
                ],
                "Resource": [
                    "arn:aws:kms:xxx",
                    "arn:aws:s3:::YOUR_BUCKET_NAME"
                ]
            },
            {
                "Effect": "Allow",
                "Action": [
                    "s3:PutObject",
                    "s3:GetObject",
                    "s3:RestoreObject",
                    "s3:DeleteObject",
                    "s3:DeleteObjectVersion",
                    "s3:GetObjectVersion",
                    "s3:GetObjectTagging",
                    "s3:PutObjectTagging",
                    "s3:GetObjectVersionTagging",
                    "s3:PutObjectVersionTagging"
                ],
                "Resource": "arn:aws:s3:::YOUR_BUCKET_NAME/YOUR_FOLDER_NAME/*"
            },
            {
                "Effect": "Allow",
                "Action": [
                    "sts:GetFederationToken"
                ],
                "Resource": [
                    "*"
                ]
            }
        ]
    }

    At the end of the policy setting, there should be 3 permissions listed in the "Summary".

    sse-kms-2

    Follow the general instructions for how to create a storage configuration in Platform Core.

    On step 3 in process above, continue with the [Optional] Server Side Encryption to enter the algorithm and key name for server-side encryption processes.

    • On "Algorithm", input aws:kms

    • On "Key Name", input the ARN KMS key: arn:aws:kms:xxx

    In addition to following the instructions to Enable Cross-Account Access (IAM User) and Enable Cross-Account Access (IAM Role), the KMS policy must include the following statement for AWS S3 Bucket with SSE-KMS Encryption (refer to the Role ARN table from the IAM user or IAM role page for the ASSUME_ROLE_ARN value):

    If your bucket uses SSE-KMS encryption with a self-managed key and you want to update your key, two things must stay in sync for Illumina to read your data:

    • The key must match: the key configured in your Illumina volume / storage configuration must be the same key that is actually used to encrypt the objects in your bucket.

    • Decrypt permission must be retained: the identity Illumina uses to read your objects must keep permission to decrypt with that key (the key policy must grant kms:Decrypt to that account/role).

    Changing your bucket's default encryption key, rotating to a new key, or restricting the key policy without updating your Illumina configuration can cause access-denied errors on files that were otherwise copied correctly.

    Create an S3 bucket with SSE-KMS

    S3-SSE-KMS must be in the same region as your Platform Core project. See the Platform Core S3 bucket documentation for more information.

    If you do not have an existing customer managed key, click Create a KMS key and follow these steps from AWS.

    Once the bucket is set, create a folder with encryption enabled in the bucket that will be linked in the Platform Core storage configuration. This folder will be connected to Platform Core as a prefix. Although it is technically possible to use the root folder, this is not recommended as it will cause the S3 bucket to no longer be available for other projects.

    Connect the S3-SSE-KMS to Platform Core

    SSE-KMS Encryption
    this page
    AWS instructions
    general instructions
    sse-kms-1
        {
            "Sid": "AllowCrossAccountAccess",
            "Effect": "Allow",
            "Principal": {
                "AWS": "ASSUME_ROLE_ARN"
            },
            "Action": [
                "kms:Encrypt",
                "kms:Decrypt",
                "kms:ReEncrypt*",
                "kms:GenerateDataKey*",
                "kms:DescribeKey"
            ],
            "Resource": "*"
        }

    Create S3-SSE-KMS configuration in Platform Core

    Although "Key prefix" is optional, it is highly recommended to use this and not use the root folder of your S3 bucket. "Key prefix" refers to the folder name in the bucket which you created.

    Once a key prefix is used in a storage configuration, no additional storage configurations can be created under that same path.

    Cross-Account Copy Setup for S3 buckets with SSE-KMS encryption

    KMS Policy

    Key Update

    XML Input Form

    Pipelines defined using the "Code" mode require either an XML-based or JSON-based input form to define the fields shown on the launch view in the user interface (UI). The XML-based input form is defined in the "XML Configuration" tab of the pipeline editing view.

    The input form XML must adhere to the input form schema.

    Empty Form

    During the creation of a Nextflow pipeline the user is given an empty form to fill out.

    <pipeline code="" version="1.0" xmlns="xsd://www.illumina.com/ica/cp/pipelinedefinition">
        <dataInputs>
        </dataInputs>
        <steps>
        </steps>
    </pipeline>

    Files

    The input files are specified within a single DataInputs node. An individual input is then specified in a separate DataInput node. A DataInput node contains following attributes:

    • code: an unique id. Required.

    • format: specifying the format of the input: FASTA, TXT, JSON, UNKNOWN, etc. Multiple entries are possible: example below. Required.

    • type: is it a FILE or a DIRECTORY? Multiple entries are not allowed. Required.

    • required: is this input required for the execution of a pipeline? Required.

    • multiValue: are multiple files as an input allowed? Required.

    • dataFilter: TBD. Optional.

    Additionally, DataInput has two elements: label for labelling the input and description for a free text description of the input.

    An example of a single file input which can be in a TXT, CSV, or FASTA format.

    To use a folder as an input the following form is required:

    For multiple files, set the attribute multiValue to true. This will make it so the variable is considered to be of type list [], so adapt your pipeline when changing from single value to multiValue.

    Settings (as opposed to files) are specified within the steps node. Settings represent any non-file input to the workflow, including but not limited to, strings, booleans, integers, etc. The following hierarchy of nodes must be followed: steps > step > tool > parameter. The parameter node must contain following attributes:

    • code: unique id. This is the parameter name that is passed to the workflow

    • minValues: how many values (at least) should be specified for this setting. If this setting is required, minValues should be set to 1.

    • maxValues: how many values (at most) should be specified for this setting

    In the code below a string setting with the identifier inp1 is specified.

    Examples of the following types of settings are shown in the subsequent sections. Within each type, the value tag can be used to denote a default value in the UI, or can be left blank to have no default. Note that setting a default value has no impact on analyses launched via the API.

    For an integer setting the following schema with an element integerType is to be used. To define an allowed range use the attributes minimumValue and maximumValue.

    Options types can be used to designate options from a drop-down list in the UI. The selected option will be passed to the workflow as a string. This currently has no impact when launching from the API, however.

    Option types can also be used to specify a boolean, for example

    For a string setting the following schema with an element stringType is to be used.

    For a boolean setting, booleanType can be used.

    One known limitation of the schema presented above is the inability to specify a parameter that can be multiple type, e.g. File or String. One way to implement this requirement would be to define two optional parameters: one for File input and the second for String input. At the moment Platform Core UI doesn't validate whether at least one of these parameters is populated - this check can be done within the pipeline itself.

    Below one can find both a main.nf and XML configuration of a generic pipeline with two optional inputs. One can use it as a template to address similar issues. If the file parameter is set, it will be used. If the str parameter is set but file is not, the str parameter will be used. If neither of both is used, the pipeline aborts with an informative error message.

    Service Connector

    Platform Core provides a Service Connector, which is a small program that runs on your local machine to sync data between the platform's cloud-hosted data store and your local computer or server. The Service Connector securely uploads data or downloads results using TLS 1.2. In order to do this, the Connector makes 2 connections:

    • A control connection, which the Connector uses to get configuration information from the platform, and to update the platform about its activities

    • A connection towards the storage node, used to transfer the actual data between your local or network storage and your cloud-based Platform Core storage.

    This Connector runs in the background, and configuration is done in the Platform Core UI, where you can add upload and download rules to meet the requirements of the current project and any new projects you may create.

    The Service Connector looks at any new files and checks their size. As long as the file size is changing, it knows data is still being added to the file and it is not ready for transfer. Only when the file size is stable and does not change anymore will it consider the file to be complete and initiate transfer. Despite this, it is still best practice to not connect the Service Connector to active folders which are used as streaming output for other processes as this can result in incomplete files being transferred when the active processes have extended compute periods in which the file size remains unchanged.

    The service connector will handle integrity checking during file transfer, which requires the calculation of hashes on the data. In addition, Transmission speed depends on the available data transfer bandwidth and connection stability. For these reasons, uploading large amounts of data can take considerable time. This can in turn result in temporarily seeing empty folders at the destination location since these are created at the beginning of the transfer process.

    1. Select Projects > your_project > Project Settings > Connectivity > Service Connectors.

    2. Select + Create.

    3. Fill out the fields in the New Connector configuration page.

    • Run the downloaded .exe file. During the installation, the installer will ask for the initialization key. Fill out the initialization key you see in the platform.

    • The installer will create an Illumina Service Connector, register it as a Windows service, and start the service. That means, if you wait for about 60 seconds, and then refresh the screen in the Platform by using the refresh button in the right top corner of the page, the connector should display as connected.

    • You can only install 1 connector on Windows. If for some reason, you need to install a new one, first uninstall the old one. You only need to do this when there is a problem with your existing connector. Upgrading a connector is also possible. To do this, you don’t need to uninstall the old one first.

    In the upload and download rules, you define different properties when setting up a connector. A connector can be used by multiple projects and a connector can have multiple upload and download rules. Configuration can be changed anytime. Changes to the configuration will be applied approximately 60 seconds after changes are made in Platform Core if the connector is already connected. If the connector is not already started when configuration changes are made in Platform Core, it will take about 60 seconds after the connector is started for the configuration changes to be propagated to the connector. The following are the different properties you can configure when setting up a connector. After adding a rule and installing the connector, you can use the Active checkbox to disable rules.

    Below is an example of a new connector setup with an Upload Rule to find all files ending with .tar or .tar.gz located within the local folder C:\Users\username\data\docker-images.

    An upload rule tells the connector which folder on your local disk it needs to watch for new files to upload. The connector contacts the platform every minute to pick up changes to upload rules. To configure upload rules for different projects, first switch into the desired project and select Connectivity. Choose the connector from the list and select Click to add a new upload rule and define the rule. The project field will be automatically filled with the project you are currently within.

    Field
    Description

    When you schedule downloads in the platform, you can choose which connector needs to download the files. That connector needs some way to know how and where it needs to download your files. That’s what a download rule is for. The connector contacts the platform every minute to pick up changes to download rules. The following are the different download rule settings.

    Field
    Description

    You can see the service connector status by the color indicator.

    Color
    Status

    When you set up your connector for the first time, and your sample files are located on a shared drive, it’s best to create a folder on your local disk, put one of the sample files in there, and do the connector setup with that folder. When this works, try to configure the shared drive.

    Transfer to and from a shared drive may be quite slow. That means it can take up to 30 minutes after you configured a shared drive before uploads start. This is due to the integrity check the connector does for each file before it starts uploading. The connector can upload from or download to a shared drive, but there are a few conditions:

    • The drive needs to be mounted locally. X:\illuminaupload or /Volumes/shareddrive/illuminaupload will work, \\shareddrive\illuminaupload or smb://shareddrive/illuminaupload will not.

    • The user running the connector must have access to the shared drive without a password being requested.

    Illumina might release new versions of the Service Connector, with improvements and/or bug fixes. You can easily download a new version of the Connector with the Download button on the Connectivity screen in the platform. After you downloaded the new installer, run it and choose the option ‘Yes, update the existing installation’.

    To uninstall the connector, perform one of the following:

    • Windows and Linux: Run the uninstaller located in the folder where the connector was installed.

    • Mac: Move the Illumina Service Connector to your Trash folder.

    The Connector has a log file containing technical information about what’s happening. When something doesn’t work, it often contains clues to why it doesn’t work. Interpreting this log file is not always easy, but it can help the support team to give a fast answer on what is wrong, so it is suggested to attach it to your email when you have upload or download problems. You can find this log file at the following location:

    \<Installation Folder>\logs\BSC.out Default: C:\Program Files (x86)\illumina\logs\BSC.out

    /<Installation Directory>/Illumina Service Connector.app/Contents/java/app/logs/BSC.out

    Default: /Applications/Illumina Service Connector.app/Contents/java/app/logs/BSC.out

    /<Installation Directory>/logs/BSC.out

    Pipeline Development in Bench (Experimental)

    The Pipeline Development Kit in Bench makes it easy to create Nextflow pipelines for Platform Core Flow. This kit consists of a number of development tools which are installed in /data/.software (regardless of which Bench image is selected) and provides the following features:

    • Import to Bench

      • From public nf-core pipelines

    CWL: Scatter-gather Method

    In bioinformatics and computational biology, the vast and growing amount of data necessitates methods and tools that can process and analyze data in parallel. This demand gave birth to the scatter-gather approach, an essential pattern in creating pipelines that offers efficient data handling and parallel processing capabilities. In this tutorial, we will demonstrate how to create a CWL pipeline utilizing the scatter-gather approach. To this purpose, we will use two widely known tools: and . Given the functionalities of both fastp and multiqc, their combination in a scatter-gather pipeline is incredibly useful. Individual datasets can be scattered across resources for parallel preprocessing with fastp. Subsequently, the outputs from each of these parallel tasks can be gathered and fed into multiqc, generating a consolidated quality report. This method not only accelerates the preprocessing of large datasets but also offers an aggregated perspective on data quality, ensuring that subsequent analyses are built upon a robust foundation.

    First, we create the two tools: fastp and multiqc. For this, we need the corresponding Docker images and CWL tool definitions. Please, look up this of our help sites to learn more how to import a tool into Platform Core. In a nutshell, once the CWL tool definition is pasted into the editor, the other tabs for editing the tool will be populated. To complete the tool, the user needs to select the corresponding Docker image and to provide a tool version (could be any string).

    For this demo, we will use the publicly available Docker images: quay.io/biocontainers/fastp:0.20.0--hdbcaa40_0 for fastp and docker.io/ewels/multiqc:v1.15 for multiqc. In this one can find how to import publicly available Docker images into Platform Core.

    Creating a Pipeline from Scratch

    This tutorial shows you how to start a new pipeline from scratch

    Cohort Analysis

    From the Cohorts menu in the left hand navigation, select a cohort created in Create Cohort to begin a cohort analysis.

    The query details can be accessed by clicking the triangle next to Show Query Details. The query details displays the selections used to create a cohort. The selections can be edited by clicking the pencil icon in the top right.

    1. Charts will be open by default. If not, click Show Charts.

    2. Use the gear

    Show Term Count: A new checkbox below "Age of Onset" that is always checked. Unchecking it hides the descendant count.

    Nextflow: Pipeline Lift
    Launch Pipelines on CLI
    CLI
    own AWS S3
    select ICA:Data_reference as MY_DATA_REFERENCE from TestTable becomes:

    select GET_IGNORE_CASE(TESTTABLE.ICA,'Data_reference') as MY_DATA_REFERENCE from TestTable

    You can also modify the data to have consistent capital usage by executing the query update YOUR_TABLE_NAME set ica = object_delete(object_insert(ica, 'data_name', ica:Data_name), 'Data_name') and repeating this process for all field names (Data_name, Data_reference, Execution_reference, Pipeline_name, Pipeline_reference, Sample_name, Sample_reference, Tenant_name and Tenant_reference).

    Select ArrayField:userEmail as User_Email, ArrayField:bundleName as Bundle_Name from YOUR_TABLE_NAME where ArrayField:boolean = true.

    If your criteria is text in the array, use the ' to delimit the text. For example:

    Select ArrayField:userEmail as User_Email, ArrayField:bundleName as Bundle_Name from YOUR_TABLE_NAME where ArrayField:userEmail = 'email_A@server.com'.

    You can also use the LIKE operator with the % wildcard if you do not know the exact content.

    Select ArrayField:userEmail as User_Email, ArrayField:bundleName as Bundle_Name from YOUR_TABLE_NAME where ArrayField:userEmail LIKE '%A@server%'

    Cohorts Data in Base

    This is a public repository, so we don't actually need a credential and this can be left blank. However, there is a limit to how many anonymous calls can be made to a GitHub repository, so if that limit is exceeded, you will encounter repo lookup rate limit reached and will not be able to import the pipeline.

    • To prevent running into this limit, select a Git credential.

    • If you don't have one, click the create button next to the Git credential. Enter the value of your personal access token and Platform Core will automatically obtain the Git username for it.

    • If you have no access token, you can create one with the Create personal access token on github.com button. The values there are already prefilled, but you can change the note at the top to easily identify for which purpose the token was generated.

    Main file path

    The main.nf file containing the pipeline logic and data flow is in the root folder, so we keep this as main.nf.

    Config file path

    nextflow.config containing the execution parameters is in the root folder, so we need to enter nextflow.config. The inputForm file will be generated based on the parameters in this file.

    Schema file path

    The schema is nextflow_schema.json, so enter this value. The inputForm file will be generated based on the parameters in this file.

    Version

    You can enter the commit id of the version you want to use or use the tag to identify the version.

    In this example, we use the tags to identify the version we want. From the screenshot below, you can see that there is a version 1.1.0 of the pipeline, so enter 1.1.0 in the tag field. When you enter this version in Platform Core, the commit-id for that tag will automatically be filled out. This commit-id is the long version, the short 7-character version is not supported.

    Project Connector Setup

    Israel (IL)

    arn:aws:iam::079623148045:role/ica_ilc1_crossacct

    Japan (JP)

    arn:aws:iam::079623148045:role/ica_apn1_crossacct

    Singapore (SG)

    arn:aws:iam::079623148045:role/ica_aps1_crossacct

    South Korea (KR)

    arn:aws:iam::079623148045:role/ica_apn2_crossacct

    Taiwan (TW)

    arn:aws:iam::079623148045:role/ica_ape2_crossacct

    UK (GB)

    arn:aws:iam::079623148045:role/ica_euw2_crossacct

    United Arab Emirates (AE)

    arn:aws:iam::079623148045:role/ica_mec1_crossacct

    United States (US-Oregon)

    arn:aws:iam::079623148045:role/ica_usw2_crossacct

    United States (US-N. Virginia)

    arn:aws:iam::079623148045:role/ica_use1_crossacct

    Object Ownership controls who owns objects written to the bucket.

    <YOUR_BUCKET_NAME>: Replace this field with the name of the S3 bucket you created for Platform Core.
    2012-10-17
    "
    ,
    "Statement": [
    {
    "Effect": "Allow",
    "Action": [
    "s3:PutBucketNotification",
    "s3:ListBucket",
    "s3:GetBucketNotification",
    "s3:GetBucketLocation"
    ],
    "Resource": [
    "arn:aws:s3:::<YOUR_BUCKET_NAME>"
    ]
    },
    {
    "Effect": "Allow",
    "Action": [
    "s3:PutObject",
    "s3:GetObject",
    "s3:RestoreObject",
    "s3:DeleteObject",
    "s3:GetObjectTagging",
    "s3:PutObjectTagging"
    ],
    "Resource": "arn:aws:s3:::<YOUR_BUCKET_NAME>/<YOUR_FOLDER_NAME>/*"
    },
    {
    "Effect": "Allow",
    "Action": [
    "sts:GetFederationToken"
    ],
    "Resource": [
    "*"
    ]
    }
    ]
    }
    2012-10-17
    "
    ,
    "Statement": [
    {
    "Sid": "AllowCrossAccountAccess",
    "Effect": "Allow",
    "Principal": {
    "AWS": "<ASSUME_ROLE_ARN>"
    },
    "Action": [
    "s3:PutObject",
    "s3:DeleteObject",
    "s3:ListMultipartUploadParts",
    "s3:AbortMultipartUpload",
    "s3:GetObject",
    "s3:GetObjectTagging",
    "s3:PutObjectTagging"
    ],
    "Resource": [
    "arn:aws:s3:::<YOUR_BUCKET_NAME>",
    "arn:aws:s3:::<YOUR_BUCKET_NAME>/*"
    ]
    }
    ]
    }

    Australia (AU)

    arn:aws:iam::079623148045:role/ica_aps2_crossacct

    Canada (CA)

    arn:aws:iam::079623148045:role/ica_cac1_crossacct

    Germany (EU)

    arn:aws:iam::079623148045:role/ica_euc1_crossacct

    India (IN)

    arn:aws:iam::079623148045:role/ica_aps3_crossacct

    Indonesia (ID)

    Be sure to replace the following fields:

    • YOUR_BUCKET_NAME: Replace this field with the name of the S3 bucket you created for Platform Core.

    • YOUR_ACCOUNT_ID: Replace this field with your account ID number.

    • YOUR_IAM_USER: Replace this field with the name of your IAM user created for Platform Core.

    Create Data Access Permission - AWS IAM Policy.
    IAM policy
    IAM user creation
    data access permissions
    organisational policies
    {
         "Version": "2012-10-17",
         "Statement": [
             {
                 "Effect": "Deny",
                 "Principal": {
                     "AWS": "*"
                 },
                 "Action": [
                     "s3:PutObject",
                     "s3:GetObject",
                     "s3:RestoreObject",
                     "s3:DeleteObject",
                     "s3:DeleteObjectVersion",
                     "s3:GetObjectVersion",
                     "s3:GetObjectTagging",
                     "s3:PutObjectTagging",
                     "s3:GetObjectVersionTagging",
                     "s3:PutObjectVersionTagging"
                 ],
                 "Resource": "arn:aws:s3:::YOUR_BUCKET_NAME/*",
                 "Condition": {
                     "ArnNotLike": {
                         "aws:PrincipalArn": [
                             "arn:aws:iam::YOUR_ACCOUNT_ID:user/YOUR_IAM_USER",
                             "arn:aws:sts::YOUR_ACCOUNT_ID:federated-user/*"
                         ]
                     }
                 }
             }
         ]
     }

    arn:aws:iam::079623148045:role/ica_aps4_crossacct

    classification: is this setting specified by the user?

    Single file input

    Folder as an input

    Multiple files as an input

    Settings

    Integers

    Options

    Strings

    Booleans

    Limitations

    minMaxValuesMessage

    The error message displayed when minValues or maxValues is not adhered to. When not set, a default message is generated.

    helpText

    A helper text about the parameter. Will be displayed in smaller font with the parameter.

    placeHolderText

    An optional short hint ( a word or short phrase) to aid the user when the field has no value.

    value

    The value of the parameter. Can be considered default value.

    minLength

    Only applied on type="textbox". Value is a positive integer.

    maxLength

    Only applied on type="textbox". Value is a positive integer.

    min

    Minimal allowed value for 'integer' and 'number' type.

    • for 'integer' type fields the minimal and maximal values are -100000000000000000 and 100000000000000000.

    • for 'number' type fields the max precision is 15 significant digits and the exponent needs to be between -300 and +300.

    max

    Maximal allowed value for 'integer' and 'number' type.

    • for 'integer' type fields the minimal and maximal values are -100000000000000000 and 100000000000000000.

    • for 'number' type fields the max precision is 15 significant digits and the exponent needs to be between -300 and +300.

    choices

    A list of choices with for each a "value", "text" (is label), "selected" (only 1 true supported), "disabled". "parent" can be used to build hierarchical choicetrees. "availableWhen" can be used for conditional presence of the choice based on values of other fields. Parent and value must be unique, you can not use the same value for both.

    fields

    The list of sub fields for type fieldgroup.

    dataFilter

    For defining the filtering when type is 'data'. Use nameFilter for matching the name of the file, dataFormat for file format and dataType for selecting between files and directories. (To see the data formats, open the file details in Platform Core and look at the Format on the data details. You can expand the dropdown list to see the syntax.) The dataType="file" also accepts S3 and HTTP(S) URLs.

    regex

    The regex pattern the value must adhere to. Only applied on type="textbox".

    regexErrorMessage

    The optional error message when the value does not adhere to the "regex". A default message will be used if this parameter is not present. It is highly recommended to set this as the default message will show the regex which is typically very technical.

    hidden

    Makes this parameter hidden. Can be made visible later in onRender.js or can be used to set hardcoded values of which the user should be aware.

    disabled

    Shows the parameter but makes editing it impossible. The value can still be altered by onRender.js.

    emptyValuesAllowed

    When maxValues is 1 or not set and emptyValuesAllowed is true, the values may contain null entries. Default is false.

    updateRenderOnChange

    When true, the onRender javascript function is triggered each time the user changes the value of this field. Default is false.

    dropValueWhenDisabled

    When this is present and true and the field has disabled being true, then the value will be omitted during the submit handling (on the onSubmit result).

    aws iam create-user --user-name illumina_core_admin
    ACCOUNT_ID=$(aws sts get-caller-identity --query Account --output text)
    aws iam attach-user-policy --policy-arn arn:aws:iam::${ACCOUNT_ID}:policy/illumina-core-admin-policy --user-name illumina_core_admin
            <pd:dataInput code="in" format="TXT, CSV, FASTA" type="FILE" required="true" multiValue="false">
                <pd:label>Input file</pd:label>
                <pd:description>Input file can be either in TXT, CSV or FASTA format.</pd:description>
            </pd:dataInput>
        <pd:dataInput code="fastq_folder" format="UNKNOWN" type="DIRECTORY" required="false" multiValue="false">
             <pd:label>fastq folder path</pd:label>
            <pd:description>Providing Fastq folder</pd:description>
        </pd:dataInput>
    <pd:dataInput code="tumor_fastqs" format="FASTQ" type="FILE" required="false" multiValue="true">
        <pd:label>Tumor FASTQs</pd:label>
        <pd:description>Tumor FASTQ files to be provided as input. FASTQ files must have "_LXXX" in its filename to denote the lane and "_RX" to denote the read number. If either is omitted, lane 1 and read 1 will be used in the FASTQ list. The tool will automatically write a FASTQ list from all files provided and process each sample in batch in tumor-only mode. However, for tumor-normal mode, only one sample each can be provided.
        </pd:description>
    </pd:dataInput>
        <pd:steps>
            <pd:step execution="MANDATORY" code="General">
                <pd:label>General</pd:label>
                <pd:description>General parameters</pd:description>
                <pd:tool code="generalparameters">
                    <pd:label>generalparameters</pd:label>
                    <pd:description></pd:description>
                    <pd:parameter code="inp1" minValues="1" maxValues="3" classification="USER">
                        <pd:label>inp1</pd:label>
                        <pd:description>first</pd:description>
                        <pd:stringType/>
                        <pd:value></pd:value>
                    </pd:parameter>
                </pd:tool>
            </pd:step>
        </pd:steps>
    <pd:parameter code="ht_seed_len" minValues="0" maxValues="1" classification="USER">
        <pd:label>Seed Length</pd:label>
        <pd:description>Initial length in nucleotides of seeds from the reference genome to populate into the hash table. Consult the DRAGEN manual for recommended lengths. Corresponds to DRAGEN argument --ht-seed-len.
        </pd:description>
        <pd:integerType minimumValue="10" maximumValue="50"/>
        <pd:value>21</pd:value>
    </pd:parameter>
    <pd:parameter code="cnv_segmentation_mode" minValues="0" maxValues="1" classification="USER">
        <pd:label>Segmentation Algorithm</pd:label>
        <pd:description> DRAGEN implements multiple segmentation algorithms, including the following algorithms, Circular Binary Segmentation (CBS) and Shifting Level Models (SLM).
        </pd:description>
        <pd:optionsType>
            <pd:option>CBS</pd:option>
            <pd:option>SLM</pd:option>
            <pd:option>HSLM</pd:option>
            <pd:option>ASLM</pd:option>
        </pd:optionsType>
        <pd:value>false</pd:value>
    </pd:parameter>
    <pd:parameter code="output_format" minValues="1" maxValues="1" classification="USER">
        <pd:label>Map/Align Output</pd:label>
        <pd:description></pd:description>
        <pd:optionsType>
            <pd:option>BAM</pd:option>
            <pd:option>CRAM</pd:option>
        </pd:optionsType>
        <pd:value>BAM</pd:value>
    </pd:parameter>
    <pd:parameter code="output_file_prefix" minValues="1" maxValues="1" classification="USER">
        <pd:label>Output File Prefix</pd:label>
        <pd:description></pd:description>
        <pd:stringType/>
        <pd:value>tumor</pd:value>
    </pd:parameter>
    <pd:parameter code="quick_qc" minValues="0" maxValues="1" classification="USER">
        <pd:label>quick_qc</pd:label>
        <pd:description></pd:description>
        <pd:booleanType/>
        <pd:value></pd:value>
    </pd:parameter>
    nextflow.enable.dsl = 2
    
    // Define parameters with default values
    params.file = false
    params.str = false
    
    // Check that at least one of the parameters is specified
    if (!params.file && !params.str) {
        error "You must specify at least one input: --file or --str"
    }
    
    process printInputs {
        
        container 'public.ecr.aws/lts/ubuntu:22.04'
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'standard-small'
    
        input:
        file(input_file)
    
        script:
        """
        echo "File contents:"
        cat $input_file
        """
    }
    
    process printInputs2 {
    
        container 'public.ecr.aws/lts/ubuntu:22.04'
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'standard-small'
    
        input:
        val(input_str)
    
        script:
        """
        echo "String input: $input_str"
        """
    }
    
    workflow {
        if (params.file) {
            file_ch = Channel.fromPath(params.file)
            file_ch.view()
            str_ch = Channel.empty()
            printInputs(file_ch)
        }
        else {
            file_ch = Channel.empty()
            str_ch = Channel.of(params.str)
            str_ch.view()
            file_ch.view()
            printInputs2(str_ch)
        } 
    }
    <?xml version="1.0" encoding="UTF-8" standalone="yes"?>
    <pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition" code="" version="1.0">
        <pd:dataInputs>
            <pd:dataInput code="file" format="TXT" type="FILE" required="false" multiValue="false">
                <pd:label>in</pd:label>
                <pd:description>Generic file input</pd:description>
            </pd:dataInput>
        </pd:dataInputs>
        <pd:steps>
            <pd:step execution="MANDATORY" code="general">
                <pd:label>General Options</pd:label>
                <pd:description locked="false"></pd:description>
                <pd:tool code="general">
                    <pd:label locked="false"></pd:label>
                    <pd:description locked="false"></pd:description>
                    <pd:parameter code="str" minValues="0" maxValues="1" classification="USER">
                        <pd:label>String</pd:label>
                        <pd:description></pd:description>
                        <pd:stringType/>
                        <pd:value>string</pd:value>
                    </pd:parameter>
                </pd:tool>
            </pd:step>
        </pd:steps>
    </pd:pipeline>
    {
      "fields": [
        {
          "id": "myTreeList",
          "type": "select",
          "label": "Selection Tree Example",
          "choices": [
            {
              "text": "trunk",
              "value": "treetrunk"
            },
            {
              "text": "branch",
              "value": "treebranch",
              "parent":"treetrunk"
            },
            {
              "text": "leaf",
              "value": "treeleaf",
              "parent":"treebranch"
            },
            {
              "text": "bird",
              "value": "happybird",
              "parent":"treebranch"
            },
            {
              "text": "cat",
              "value": "cat",
              "parent": "treetrunk",
              "disabled": true
            }
          ],
          "minValues": 1,
          "maxValues": 3,
          "helpText": "This is a tree example"
        }
      ]
    }
    Name - Enter the name of the connector.
  • Status - This is automatically updated with the actual status, you do not need to enter anything here.

  • Debug Information Accessible by Illumina (optional) - Illumina support can request connector debugging information to help diagnose issues. For security reasons, support can only collect this data if the option Debug Information Accessible by Illumina is active. You can choose to either proactively enable this when encountering issues to speed up diagnosis or to only activate it when support requests access. You can at any time revoke access again by deselecting the option.

  • Description (optional) - Enter any additional information you want to show for this connector.

  • Mode (required) - Specify if the connector can upload data, download data, both or neither.

  • Operating system (required) - Select your server or computer operating system.

  • Add any upload or download rules. See Connector Rules below.

  • Select Save and download the connector (top right). An initialization key will be displayed in the platform now. Copy this value as it will be needed during installation.

  • Launch the installer after the download completes and follow the on-screen prompts to complete the installation, including entering the initialization key copied in the previous step. Do not install the connector in the upload folder as this will result in the connector attempting to upload itself and the associated log files.

    • Double click the downloaded .dmg file. Double click Illumina Service Connector in the window that opens to start the installer. Run through the installer, and fill out the initialization key when asked for it.

    • To start the connector once installed or after a reboot, open the app. You can find the app on the location where you installed it. The connector icon will appear in your dock when the app is running.

    • In the platform on the Connectivity page, you can check whether your local connector has been connected with the platform. This can take 60 seconds after you started your connector locally, and you may need to refresh the Connectivity page using the refresh button in the top right corner of the page to see the latest status of your connector.

    • The connector app needs to be closed to shut down your computer. You can do this from within your dock.

    • Installations require Java 11 or later. You can check this with ‘java –version’ from a command line terminal. With Java installed, you can run the installer from the command line using the command bash illumina_unix_develop.sh.

    • Depending on whether you have an X server running or not, it will display a UI, or follow a command line installation procedure. You can force a command line installation by adding a –c flag: bash illumina_unix_develop.sh -c.

    • The connector can be started by running ./illuminaserviceconnector start from the folder in which the connector was installed.

    File pattern

    Files with filenames that match the string/pattern will be uploaded.

    Location

    The location the data will be uploaded to.

    Project

    The project the data will be uploaded to.

    Description

    Additional information about the upload rule.

    Assign Format

    Select which data format tag the uploaded files will receive. This is used for various things like filtering.

    Data owner

    The owner of the data after upload.

    Target Local folder

    The folder path on the local machine where the files will be downloaded to.

    Description

    Additional information about the download rule.

    Format

    The format the files must comply to in order to be scheduled as downloaded.

    Project

    The projects the rule applies to.

    red

    -

    The user who runs the Illumina Service Connector process on the Linux machine needs to have read, write and execute permissions on the installation folder.
    Default: /usr/local/illumina

    Name

    Name of the upload rule.

    Active

    Set to true to have this rule be active. This allows you to deactivate rules without deleting them.

    Local folder

    The folder path on the local machine where files to be uploaded are stored.

    Name

    Name of the download rule.

    Active

    Set to true to have this rule be active. This allows you to deactivate rules without deleting them.

    Order of execution

    If using multiple download rules, set the order the rules are performed.

    green

    Connected/Active

    orange

    Pending installation

    grey

    Installed/Inactive

    Both the CLI and the service connector require x86 architecture. For ARM-based architecture on Mac or Windows, you need to keep x86 emulation enabled. Linux does not support x86 emulation.

    Creating a New Connector

    Connector Rules

    Upload Rules

    Download Rules

    Connector Status

    Shared Drives

    Update connector to newer version

    Uninstall a connector

    Log files

    Connector setup

    From existing Platform Core Flow Nextflow pipelines

  • Run in Bench

  • Modify and re-run in Bench, providing fast development iterations

  • Deploy to Flow

  • Launch validation in Flow

    • Recommended workspace size: Nf-core Nextflow pipelines typically require 4 or more cores to run.

    • The pipeline development tools require

      • Conda which is automatically installed by “pipeline-dev” if conda-miniconda.installer.ica-userspace.sh is present in the image.

      • Nextflow (version 24.10.2 is automatically installed using conda, or you can use other versions)

      • git (automatically installed using conda)

      • jq, curl (which should be made available in the image)

    Pipeline development tools work best when the following items are defined:

    • Nextflow profiles:

      • test profile, specifying inputs appropriate for a validation run

      • docker profile, instructing NextFlow to use Docker

    • nextflow_schema.json, as described . This is useful for the launch UI generation. The nf-core CLI tool (installable via pip install nf-core) offers extensive help to create and maintain this schema.

    Platform Core Flow adds one additional constraint. The output directory out is the only one automatically copied to the Project data when a Platform Core Flow analysis completes. The -outdir parameter recommended by nf-core should therefore be set to--outdir=out when running as a Flow pipeline.

    These are installed in /data/.software (which should be in your $PATH), the pipeline-dev script is the front-end to the other pipeline-dev-* tools.

    Pipeline-dev fulfils a number of roles:

    • Checks that the environment contains the required tools (conda, nextflow, etc) and offers to install them if needed.

    • Checks that the fast data mounts are present (/data/mounts/project etc.) – it is useful to check regularly, as they get unmounted when a workspace is stopped and restarted.

    • Redirects stdout and stderr to .pipeline-dev.log, with the history of log files kept as .pipeline-dev.log.<log date>.

    • Launches the appropriate sub-tool.

    • Prints out errors with backtrace, to help report issues.


    A pipeline-dev project relies on the following Folder structure, which is auto-generated when using the pipeline-dev import* tools.

    • Project base folder

      • nextflow-src: Platform-agnostic Nextflow code, for example the github contents of an nf-core pipeline, or your usual nextflow source code.

        • main.nf

        • nextflow.config

        • nextflow_schema.json

      • pipeline-dev.project-info: contains project name, description, etc.

      • nextflow-bench.config (automatically generated when needed): contains definitions for bench.

      • ica-flow-config: Directory of files used when deploying pipeline to Flow.

        • inputForm.json (if not present, gets generated from nextflow-src/nextflow_schema.json): input form as defined in ICA Flow.

        • onSubmit.js, onRender.js (optional, generated at the same time as inputForm.json): javascript code to go with the input form.

    The above-mentioned project structure must be generated manually. The nf-core CLI tools can assist to generate the nextflow_schema.json. Tutorial Pipeline from Scratch goes into more details about this use case.

    $ pipeline-dev import-from-nextflow <repo name e.g. nf-core/demo>

    A directory with the same name as the nextflow/nf-core pipeline is created, and the Nextflow files are pulled into the nextflow-src subdirectory.

    Tutorial Nf Core Pipelines goes into more details about this use case.

    $ pipeline-dev import-from-flow [--analysis-id=…] 

    A directory called imported-flow-analysis is created and the analysis+pipeline assets are downloaded.

    Tutorial goes into more details about this use case.


    Optional parameters --local / --sge can be added to force the execution on the local workspace node, or on the workspace cluster (when available). Otherwise, the presence of a cluster is automatically detected and used.

    The script then launches nextflow. The full nextflow command line is printed and launched.

    In case of errors, full logs are saved as .pipeline-dev.log

    Nextflow output

    Nextflow can run processes with and without Docker images. In the context of pipeline development, the pipeline-dev tools assume Docker images are used, in particular during execution with the nextflow --profile docker.

    In NextFlow, Docker images can be specified at the process level

    • This is done with the container "<image_name:version>" directive, which can be specified.

      • in nextflow config files (preferred method when following the nf-core best practices).

      • or at the start of each process definition.

    • Each process can use a different docker image.

    • It is highly recommended to always specify an image. If no Docker image is specified, Nextflow will report this. In Platform Core, a basic image will be used but with no guarantee that the necessary tools are available.

    Resources such as #cpu and memory can be specified as described here See containers or our tutorials for details about Nextflow-Docker syntax.

    Bench can push/pull/create/modify Docker images, as described in Containers.


    This command does the following:

    1. Generate the JSON file describing the Platform Core Flow user interface.

      • If ica-flow-config/inputForm.json doesn’t exist: generate it from nextflow-src/nextflow_swagger.json .

    2. Generate the JSON file containing the validation launch inputs.

      • If ica-flow-config/launchPayload_inputFormValues.json doesn’t exist: generate it from nextflow --profile test inputs.

      • If local files are used as validation inputs or as default input values:

        • copy them to

    3. Identify the pipeline name to use for this new pipeline deployment:

      • If a deployment has already occurred in this project, or if the project was imported from an existing Flow pipeline, start from this pipeline name. Otherwise start from the project name.

      • Identify which already-deployed pipelines have the same base name, with or without suffixes that could be some versioning (_v<number>, _<number>, _<date>).

    4. A new Platform Core Flow pipeline gets created (except in case of pipeline update) .

      • The current Nextflow version in Bench is used to select the best Nextflow version to be used in Flow.

    5. nextflow-src folder is uploaded file by file as pipeline assets.

    Output Example:

    The pipeline name, id and URL are printed out, and if your environment allows, Ctrl+Click/Option+Click/Right click can open the URL in a browser.

    Opening the URL of the pipeline and clicking on Start Analysis shows the generated user interface:


    The ica-flow-config/launchPayload_inputFormValues.json file generated in the previous step is submitted to Platform Core Flow to start an analysis with the same validation inputs as “nextflow --profile test”.

    Output Example:

    launch-validation-in-flow

    The analysis name, id and URL are printed out, and if your environment allows, Ctrl+Click/Option+Click/Right click can open the URL in a browser.


    • Creating a Pipeline from Scratch

    • nf-core Pipelines

    • Updating an Existing Flow Pipeline

    Introduction

    $ pipeline-dev run-in-bench [--local|--sge] 
    $ pipeline-dev deploy-as-flow-pipeline [--create|--update] 
    $ pipeline-dev launch-validation-in-flow 

    Prerequisites

    NextFlow Requirements / Best Practices

    Pipeline Development Tools

    New Bench pipeline development tools only become active after a workspace reboot.

    Usage

    1) Starting a new Project

    If you start a project manually, you must follow the same folder structure.

    Pipeline Sources

    2) Running in Bench

    Currently, not all corner cases are covered by command line options. Please start from the nextflow command printed by the tool and extend it based on your specific needs.

    Output Example

    Container (Docker) images

    3) Deploying to Platform Core Flow

    4) Launching Validation in Flow

    Tutorials

    Furthermore, we will use the following CWL tool definitions:

    and

    Once the tools are created, we will create the pipeline itself using these two tools at Projects > your_project > Flow > Pipelines > CWL > Graphical:

    • On the Definition tab, go to the tool repository and drag and drop the two tools which you just created on the pipeline editor.

    • Connect the JSON output of fastp to multiqc input by hovering over the middle of the round, blue connector of the output until the icon changes to a hand and then drag the connection to the first input of multiqc. You can use the magnification symbols to make it easier to connect these tools.

    • Above the diagram, drag and drop two input FASTQ files and an output HTML file on to the pipeline editor and connect the blue markers to match the diagram below.

    fastp_multiqc

    Relevant aspects of the pipeline:

    • Both inputs are multivalue (as can be seen on the screenshot)

    • Ensure that the step fastp has scattering configured: it scatters on both inputs using the scatter method 'dotproduct'. This means that as many instances of this step will be executed as there are pairs of FASTQ files. To indicate that this step is executed multiple times, the icons of both inputs have doubled borders.

    Both input arrays (Read1 and Read2) must be matched. Currently an automatic sorting of input arrays is not supported. You have to take care of matching the input arrays which can be done in either one of two ways (besides the manual specification in the GUI):

    • Invoke this pipeline in CLI using Bash functionality to sort the arrays

    • Add a tool to the pipeline which will intake array of all FASTQ files, spread them on R1 and R2 suffixes, and sort them.

    We will describe the second way in more detail. The tool will be based on public python Docker docker.io/python:3.10 and have the following definition. In this tool we are providing the Python script spread_script.py via Dirent feature.

    Now this tool can added to the pipeline before fastp step.

    Creating the tools

    fastp
    multiqc
    part
    tutorial
    #!/usr/bin/env cwl-runner
    
    cwlVersion: v1.0
    class: CommandLineTool
    requirements:
    - class: InlineJavascriptRequirement
    label: fastp
    doc: Modified from https://github.com/nigyta/bact_genome/blob/master/cwl/tool/fastp/fastp.cwl
    inputs:
      fastq1:
        type: File
        inputBinding:
          prefix: -i
      fastq2:
        type:
        - File
        - 'null'
        inputBinding:
          prefix: -I
      threads:
        type:
        - int
        - 'null'
        default: 1
        inputBinding:
          prefix: --thread
      qualified_phred_quality:
        type:
        - int
        - 'null'
        default: 20
        inputBinding:
          prefix: --qualified_quality_phred
      unqualified_phred_quality:
        type:
        - int
        - 'null'
        default: 20
        inputBinding:
          prefix: --unqualified_percent_limit
      min_length_required:
        type:
        - int
        - 'null'
        default: 50
        inputBinding:
          prefix: --length_required
      force_polyg_tail_trimming:
        type:
        - boolean
        - 'null'
        inputBinding:
          prefix: --trim_poly_g
      disable_trim_poly_g:
        type:
        - boolean
        - 'null'
        default: true
        inputBinding:
          prefix: --disable_trim_poly_g
      base_correction:
        type:
        - boolean
        - 'null'
        default: true
        inputBinding:
          prefix: --correction
    outputs:
      out_fastq1:
        type: File
        outputBinding:
          glob:
          - $(inputs.fastq1.nameroot).fastp.fastq
      out_fastq2:
        type:
        - File
        - 'null'
        outputBinding:
          glob:
          - $(inputs.fastq2.nameroot).fastp.fastq
      html_report:
        type: File
        outputBinding:
          glob:
          - fastp.html
      json_report:
        type: File
        outputBinding:
          glob:
          - fastp.json
    arguments:
    - prefix: -o
      valueFrom: $(inputs.fastq1.nameroot).fastp.fastq
    - |
      ${
        if (inputs.fastq2){
          return '-O';
        } else {
          return '';
        }
      }
    - |
      ${
        if (inputs.fastq2){
          return inputs.fastq2.nameroot + ".fastp.fastq";
        } else {
          return '';
        }
      }
    baseCommand:
    - fastp
    #!/usr/bin/env cwl-runner
    
    cwlVersion: cwl:v1.0
    class: CommandLineTool
    label: MultiQC
    doc: MultiQC is a tool to create a single report with interactive plots for multiple
      bioinformatics analyses across many samples.
    inputs:
      files:
        type:
        - type: array
          items: File
        - 'null'
        doc: Files containing the result of quality analysis.
        inputBinding:
          position: 2
      directories:
        type:
        - type: array
          items: Directory
        - 'null'
        doc: Directories containing the result of quality analysis.
        inputBinding:
          position: 3
      report_name:
        type: string
        doc: Name of output report, without path but with full file name (e.g. report.html).
        default: multiqc_report.html
        inputBinding:
          position: 1
          prefix: -n
    outputs:
      report:
        type: File
        outputBinding:
          glob:
          - '*.html'
    baseCommand:
    - multiqc
    #!/usr/bin/env cwl-runner
    
    cwlVersion: v1.0
    class: CommandLineTool
    requirements:
    - class: InlineJavascriptRequirement
    - class: InitialWorkDirRequirement
      listing:
      - entry: "import argparse\nimport os\nimport json\n\n# Create argument parser\n\
          parser = argparse.ArgumentParser()\nparser.add_argument(\"-i\", \"--inputFiles\"\
          , type=str, required=True, help=\"Input files\")\n\n# Parse the arguments\n\
          args = parser.parse_args()\n\n# Split the inputFiles string into a list of file\
          \ paths\ninput_files = args.inputFiles.split(',')\n\n# Sort the input files\
          \ by the base filename\ninput_files = sorted(input_files, key=lambda x: os.path.basename(x))\n\
          \n\n# Separate the files into left and right arrays, preserving the order\n\
          left_files = [file for file in input_files if '_R1_' in os.path.basename(file)]\n\
          right_files = [file for file in input_files if '_R2_' in os.path.basename(file)]\n\
          \n# Print the left files for debugging\nprint(\"Left files:\", left_files)\n\
          \n# Print the left files for debugging\nprint(\"Right files:\", right_files)\n\
          \n# Ensure left and right files are matched\nassert len(left_files) == len(right_files),\
          \ \"Mismatch in number of left and right files\"\n\n    \n# Write the left files\
          \ to a JSON file\nwith open('left_files.json', 'w') as outfile:\n    left_files_objects\
          \ = [{\"class\": \"File\", \"path\": file} for file in left_files]\n    json.dump(left_files_objects,\
          \ outfile)\n\n# Write the right files to a JSON file\nwith open('right_files.json',\
          \ 'w') as outfile:\n    right_files_objects = [{\"class\": \"File\", \"path\"\
          : file} for file in right_files]\n    json.dump(right_files_objects, outfile)\n\
          \n"
        entryname: spread_script.py
        writable: false
    label: spread_items
    inputs:
      inputFiles:
        type:
          type: array
          items: File
        inputBinding:
          separate: false
          prefix: -i
          itemSeparator: ','
    outputs:
      leftFiles:
        type:
          type: array
          items: File
        outputBinding:
          glob:
          - left_files.json
          loadContents: true
          outputEval: $(JSON.parse(self[0].contents))
      rightFiles:
        type:
          type: array
          items: File
        outputBinding:
          glob:
          - right_files.json
          loadContents: true
          outputEval: $(JSON.parse(self[0].contents))
    baseCommand:
    - python3
    - spread_script.py

    Pipeline

    Important remark

    deploy pipeline as an ICA Flow pipeline

  • launch Flow validation test from Bench


  • Start Bench workspace

    • For this tutorial, any instance size will work, even the smallest standard-small.

    • Select the single user workspace permissions (aka "Access limited to workspace owner "), which allows us to deploy pipelines.

    • A small amount of disk space (10GB) will be enough.

    We are going to wrap the "gzip" linux compression tool with inputs:

    • 1 file

    • compression level: integer between 1 and 9


    Here is an example of NextFlow code that wraps the bzip2 command and publishes the final output in the “out” folder:

    Save this file as nextflow-src/main.nf, and check that it works:


    We now need to:

    • Use Docker

    • Follow some nf-core best practices to make our source+test compatible with the pipeline-dev tools

    In NextFlow, Docker images can be specified at the process level

    • Each process may use a different docker image

    • It is highly recommended to always specify an image. If no Docker image is specified, Nextflow will report this. In ICA, a basic image will be used but with no guarantee that the necessary tools are available.

    Specifying the Docker image is done with the container '<image_name:version>' directive, which can be specified

    • at the start of each process definition

    • or in nextflow config files (preferred when following nf-core guidelines)

    For example, create nextflow-src/nextflow.config:

    We can now run with nextflow's -with-docker option:

    Following some nf-core best practices to make our source+test compatible with the pipeline-dev tools:

    Here is an example of “test” profile that can be added to nextflow-src/nextflow.config to define some input values appropriate for a validation run:

    With this profile defined, we can now run the same test as before with this command:

    A “docker” profile is also present in all nf-core pipelines. Our pipeline-dev tools will make use of it, so let’s define it:

    We can now run the same test as before with this command:

    We also have enough structure in place to start using the pipeline-dev command:

    In order to deploy our pipeline to ICA, we need to generate the user interface input form.

    This is done by using nf-core's recommended nextflow_schema.json.

    For our simple example, we generate a minimal one by hand (done by using one of the nf-core pipelines as example):

    In the next step, this gets converted to the ica-flow-config/inputForm.json file.


    We just need to create a final file, which we had skipped until now: Our project description file, which can be created via the command pipeline-dev project-info --init:

    We can now run:

    After generating the ICA-Flow-specific files in the ica-flow-config folder (JSON input specs for Flow launch UI + list of inputs for next step's validation launch), the tool identifies which previous versions of the same pipeline have already been deployed (in ICA Flow, pipeline versioning is done by including the version number in the pipeline name).

    It then asks if we want to update the latest version or create a new one.

    Choose "3" and enter a name of your choice to avoid conflicts with all the others users following this same tutorial.

    At the end, the URL of the pipeline is displayed. If you are using a terminal that supports it, Ctrl+click or middle-click can open this URL in your browser.


    This launches an analysis in ICA Flow, using the same inputs as the pipeline's "test" profile.

    Some of the input files will have been copied to your ICA project in order for the analysis launch to work. They are stored in the folder /data/project/bench-pipeline-dev/temp-data.

    Introduction

    prepare linux tool + validation inputs
    wrap in Nextflow
    wrap the pipeline in Bench
    mkdir demo_gzip
    cd demo_gzip
    echo test > test_input.txt
    mkdir nextflow-src
    # Create nextflow-src/main.nf using contents below
    vi nextflow-src/main.nf
    nextflow.enable.dsl=2
     
    process COMPRESS {
      input:
        path input_file
        val compression_level
     
      output:
        path "${input_file.simpleName}.gz" // .simpleName keeps just the filename
        publishDir 'out', mode: 'symlink'
     
      script:
        """
        gzip -c -${compression_level} ${input_file} > ${input_file.simpleName}.gz
        """
    }
     
    workflow {
        input_path = file(params.input_file)
        gzip_out = COMPRESS(input_path, params.compression_level)
    }
    nextflow run nextflow-src/ --input_file test_input.txt --compression_level 5
    process.container = 'ubuntu:latest'
    nextflow run nextflow-src/ --input_file test_input.txt --compression_level 5 -with-docker
    process.container = 'ubuntu:latest'
     
    profiles {
      test {
        params {
          input_file = 'test_input.txt'
          compression_level = 5
        }
      }
    }
    nextflow run nextflow-src/ -profile test -with-docker
    process.container = 'ubuntu:latest'
     
    profiles {
      test {
        params {
          input_file = 'test_input.txt'
          compression_level = 5
        }
      }
     
      docker {
        docker.enabled = true
      }
    }
    nextflow run nextflow-src/ -profile test,docker
    pipeline-dev run-in-bench
    {
        "$defs": {
            "input_output_options": {
                "title": "Input/output options",
                "properties": {
                    "input_file": {
                        "description": "Input file to compress",
                        "help_text": "The file that will get compressed",
                        "type": "string",
                        "format": "file-path"
                    },
                    "compression_level": {
                        "type": "integer",
                        "description": "Compression level to use (1-9)",
                        "default": 5,
                        "minimum": 1,
                        "maximum": 9
                   }
                }
            }
        }
    }
    $ pipeline-dev project-info --init
     
    pipeline-dev.project-info not found. Let's create it with 2 questions:
     
    Please enter your project name: demo_gzip
    Please enter a project description: Bench gzip demo
    pipeline-dev deploy-as-flow-pipeline
    pipeline-dev launch-validation-in-flow
    /data/demo $ pipeline-dev launch-validation-in-flow
    
    pipelineld: 331f209d-2a72-48cd-aa69-070142f57f73
    Getting Analysis Storage Id
    Launching as ICA Flow Analysis...
    ICA Analysis created:
    - Name: Test demo_gzip
    - Id: 17106efc-7884-4121-a66d-b551a782b620
    - Url: https://stage.v2.stratus.illumina.com/ica/projects/1873043/analyses/17106efc-7884-4121-a66d-b551a782620

    Preparation

    We intentionally do not include sanity checks, to keep this scenario simple.

    Creation of test file:

    Wrapping in Nextflow

    nextflow-src/main.nf

    Result

    Wrap the Pipeline in Bench

    Using Docker:

    Create NextFlow “test” profile

    nextflow-src/nextflow.config

    Create NextFlow “docker” profile

    nextflow-src/nextflow.config

    nextflow-src/nextflow_schema.json

    Note: For large pipelines, as described on the nf-core

    Manually building JSONSchema documents is not trivial and can be very error prone. Instead, the nf-core pipelines schema build command collects your pipeline parameters and gives interactive prompts about any missing or unexpected params. If no existing schema is found it will create one for you.

    We recommend looking into "nf-core pipelines schema build -d nextflow-src/", which comes with a web builder to add descriptions etc.

    Deploy as a Flow Pipeline

    pipeline-dev.project_info

    Run Validation Test in Flow

    Result

    icon in the top-right to change viewable chart settings.
  • There are four charts available to view summary counts of attributes within a cohort as histogram plots.

  • Click Hide Charts to hide the histograms.

    1. Display time-stamped events and observations for a single subject on a timeline.The timeline view is visible to only those subjects which have time-series data.

    2. The following attributes are displayed in timeline view:

      • Diagnosed and Self-Reported Diseases:

        • Start and end dates

        • Progression vs. remission

      • Medication and Other Treatments:

        • Prescribed and self-medicated

        • Start date, end date, and dosage at every time point

    3. The timeline utilizes age (at diagnosis, at event, at measurement) as the x-axis and attribute name as the y-axis. If the birthdate is not recorded for a subject, then you can switch to Date to visualize data.

    4. In the default view, the timeline shows the first five disease data and the first five drug/medication data in the plot. You can choose different attributes or change the order of existing attributes by clicking on the “select attribute” button.

    5. The x-axis shows the person’s age in years, with data points initially displayed between ages 0 to 100. You can zoom in by selecting the desired range to visualize data points within the selected age range.

    6. Each event is represented by a dot in the corresponding track. Events in the same track can be connected by lines to indicate the start and end period of an event.

    1. By Default, the Subjects tab is displayed.

    2. The Subjects tab with a list of all subjects matching your criteria is displayed below Charts with a link to each Subject by ID and other high-level information. By clicking a subject ID, you will be brought to the data collected at the Subject level.

    3. Search for a specific subject by typing the Subject ID into the Search Subjects text box.

    4. Get all details available on a subject by clicking the hyperlinked Subject ID in the Subject list.

    To Exclude specific subjects from subsequent analysis, such as marker frequencies or gene-level aggregated views, you can uncheck the box at the beginning of each row in the subject list. You will then be prompted to save any exclusion(s).

    You can Export the list of subjects either to your Platform Core project's data folder or to your local disk as a TSV file for subsequent use. Any export will omit subjects that you excluded after you saved those changes. For more information, see at the bottom of this page.

    1. Specific subjects can be removed from a Cohort.

    2. Select the Subjects tab.

    3. Subjects in the Cohort, by default are checked.

    4. To remove a specific subject from a Cohort, uncheck the checkbox next to subjects to remove from a Cohort.

    5. Check box selections are maintained while browsing through the pages of the subject list.

    6. Click Save Cohort to save the subjects you would like to exclude.

    7. The specific subjects will no longer be counted in all analysis visualizations.

    8. The specific excluded subjects will be saved for the Cohort.

    9. To add the subjects back to the Cohort, select the checkboxes to checked and click Save Cohort.

    For each individual cohort, display a table of all observed SVs that overlap with a given gene.

    1. Click the Marker Frequency tab, then click the Gene Expression tab.

    2. Down-regulated genes are displayed in blue and Up-regulated genes are displayed in red.

    3. A frequency in the Cohort is displayed and the Matching number/Total is also displayed in the chart.

    4. Genes can be searched by using the Search Genes text box.

    1. You are brought to the Gene tab under the Gene Summary sub-tab.

    2. Select a Gene by typing the gene name into the Search Genes text box.

    3. A Gene Summary will be displayed that lists information and links to public resources about the selected gene.

    4. A cytogenic map will be displayed based on the selected gene and a vertical orange bar represents gene location in the chromosome.

    5. Click the Variants tab and Show legend and filters if it does not open by default.

    6. Below the interactive legend, you see a set of analysis tracks: Needle Plot, Primate AI, Pathogenic variants, and Exons.

    7. The Needle Plot allows toggling the plot by gnomAD frequency and Sample Count. Select Sample Count in the Plot by legend above the plot. You can also filter the plot to only show variants above or below a certain cut-off for gnomAD frequency in percent or absolute sample count.

    8. The Needle Plot allows filtering by PrimateAI Score.

      • Set a lower (>=) or upper (<=) threshold for the PrimateAI Score to filter variants.

      • Enter the threshold value in the text box located below the gnomadFreq/SampleCount input box.

    9. The following filters are always shown and can be independently set: %gnomAD Frequency, Sample Count, PrimateAI Score. Changes made to these filters are immediately reflected in both the needle plot and the variant list below.

    10. Click on a variant's needle pin to view details about the variant from public resources and counts of variants in the selected cohort by disease category. If you want to view all subjects that carry the given variant, click on the sample count link, which will take you to the list of subjects (see above).

    11. Use the Exon zoom bar from each end of the Amino Acid sequence to zoom in on the gene domain to better separate observations.

    12. The Pathogenic Variant track shows pop-up details with pathogenicity calls, phenotypes, submitter and a link to the ClinVar entry when you hover over the purple triangles.

    13. Below the needle plot is a full listing of variants displayed in the needle plot visualization

      • Display only variants shown in the plot above. toggle (enabled by default) syncs the table with the Needle Plot. When the toggle is on, the table will display only the variants shown in the Needle Plot, applying all active filters (e.g., variant type, somatic/germline, sample count). When the toggle is off, all reported variants are displayed in the table and table-based filters can be used.

      • Export to CSV: When the views are synchronized (toggle on), the filtered list of variants can be exported to a CSV file for further analysis.The Phenotypes tab

    1. The Gene Expression tab shows known gene expression data from tissue types in GTEx.

    2. The Genetic Burden Test will only be available for de novo variants only.

    1. Click the Correlation tab.

    2. In X-axis category, select Clinical.

    3. In X-axis Attribute, select a clinical attribute.

    4. In Y-axis category, select Clinical.

    5. In Y-Axis Attribute, select another clinical attribute.

    6. You will be shown a bubble plot comparing the first clinical attribute on the x-axis to second attributes on the y-axis.

    7. The size of the bubbles correspond to the number of subjects falling into those categories.

    To see a breakdown of Somatic Mutations vs. RNA Expression levels perform the following steps:

    This comparison is for a Cancer case.

    1. Click the Correlation tab.

    2. In X-axis category, select Somatic.

    3. In X-axis Attribute, select a gene.

    4. In Y-axis category, select RNA expression.

    5. In Y-Axis Attribute, type a gene and leave Reference Type, NORMAL.

    6. Click Continuous to see violin plots of compared variables.

    This comparison is for a Cancer case.

    1. Click the Correlation tab.

    2. In X-axis category, select Somatic.

    3. In X-axis Attribute, type a gene name.

    4. In Y-axis category, select Clinical.

    5. In Y-Axis Attribute, select a clinical attribute.

    1. Click the Molecular Breakdown tab.

    2. In Enter a clinical Attribute, select a clinical attribute.

    3. In Enter a gene, select a gene by typing a gene name.

    4. You are shown a stacked bar-chart by the clinical attribute selected values on the Y-axis.

    5. For each attribute value the bar represents the % of Subjects with RNA Expression, Somatic Mutation, and Multiple Alterations.

    If there is Copy Number Variant data in the cohort:

    1. Click the CNV tab.

    2. A graph will show CNV a Sample Percentage on the Y-axis and Chromosomes on the X-axis.

    3. Any value above Zero is a copy number gain, and any value below Zero is a copy number loss.

    4. Click Chromosome: to select a specific chromosome position.

    Platform Core allows integrated analysis in a computation workspace. You can export your cohort definitions and, in combination with molecular data in your Platform Core project data, perform, for example, a GWAS analysis.

    1. Confirm the VCF data for your analysis is in Platform Core project data.

    2. From within your Platform Core project, start a Bench workspace. See Bench for more details.

    3. Navigate back to Platform Core Cohorts.

    4. Create a Cohort of subjects of interest using .

    5. From the Subjects tab click Export subjects... from the top-right of the subject list. The file can be downloaded to the browser or Platform Core project data.

    6. We suggest using export ...to Data Folder for immediate access to this data in Bench or other areas of Platform Core.

    7. Create another cohort if needed for your Research and complete the last 3 steps.

    8. Navigate to the Bench workspace created in the second step.

    9. After the workspace has started up, click Access.

    10. Find the /Project/ folder in the Workspace file navigation.

    11. This folder will contain your cohort files created along with any pipeline output data needed for your workspace analysis.

    Cohort Analysis

    Query Details

    Charts

    Single Subject Timeline View:

    Measurement Section: A summary of measurements (without values) is displayed under the section titled "Measurements and Laboratory Values Available." You can click a link to access the Timeline View for detailed results.

    Drug Section: The "Drug Name" section lists drug names without repeating the header "Drug Name" for each entry.

    Subjects

    Remove a Subject

    Structural variant aggregation: Marker Frequency analysis

    Marker Frequency

    Genes

    For "Stop Lost" Consequence Variants:

    • The stop_lost consequence is mapped as Frameshift, Stop lost in the tooltip.

    • The Stop gained|lost value includes both stop gain and stop loss variants.

    Correlation

    For every correlation, subjects contained in each count can be viewed by selecting the count on the bubble or the count on the X-axis and Y-axis.

    Clinical vs. Clinical Attribute Comparison – Bubble Plot

    Molecular vs. Molecular Attribute Comparison – Bubble Plot

    Clinical vs. Molecular Attribute Comparison – Bubble Plot

    Molecular Breakdown

    For each of the aforementioned bubble plots, you can view the list of subjects by following the link under each subject count associated with an individual bubble or axis label. This will take you to the list of subjects view, see above.

    CNV

    Subject Export for Analysis in Platform Core Bench

    Boolean

    True or false, cannot be multiple value

    Date

    e.g. 2021-09-20

    Date time

    e.g. 2021-09-20 11:43:53, saved in UTC

    Enumeration

    select value from list. Enter the values in the options field which appears when you have selected enumeration type.

    Field Group

    Groups fields. Once you have chosen this, the +Add group field becomes available to add fields to this group.

    Filled by pipeline

    Fields that need to be filled by pipeline should be part of the same group. This group will automatically be multiple value and values will be available after pipeline execution. This property is only available for the Field Group type.

    If you have fields that are filled by the pipeline you can create an example JSON structure indicating what the json in an analysis output file with name metadata.response.json should look like to fill in the metadata fields of this model. Use System Settings > Metadata Models > your_metadata_model > Manage > Generate example JSON. Only fields in groups marked as Filled by pipeline are included.

    Team

    Projects can be shared by updating the project's Team. You can add team members as

    • Existing user within the current tenant

    • By adding their E-mail address

    • As entire Workgroup within the current tenant

    Select the corresponding option under Projects > your_project > Project Settings > Team > + Add.

    Users can accept or reject invites. The status column shows a green checkmark for accept, an orange question mark for users that have not responded and a red x for users that rejected the invite.

    The project owner has administrator-level project rights. To change the project owner, select the Edit project owner button at the top right and select the new project owner from the list. This can be done by the current project owner, the tenant administrator or a project administrator of the current project.

    Every user added to the project team will need to have a role assigned for specific categories of functionality in Platform Core. These categories are:

    • (contains data and tools to execute analysis)

    • (secondary analysis pipelines)

    • (genomics data aggregation and analysis)

    While the categories will determine most of what a user can do or see, explicit upload and download rights need to be granted for users. Select the checkbox next to Download allowed and Upload allowed when adding a team member.

    The sections below describe the roles and their allowed actions.

    No Access
    Data Provider
    Viewer
    Contributor
    Administrator
    No Access
    Viewer
    Contributor
    No Access
    Viewer
    Contributor
    No Access
    Contributor
    Administrator

    Updating an Existing Flow Pipeline

    Introduction

    This tutorial shows you how to

    • import an existing ICA Flow pipeline with a supporting validation analysis

    • run the pipeline in Bench

      • the execution

    • Iterative development: and validate in Bench

      • Modify code

      • Modify Docker image contents ( or method)

    Make sure you have access in ICA Flow to:

    • the pipeline you want to work with

    • an analysis exercising this pipeline, preferably with a short execution time, to use as validation test

    For this tutorial, the instance size depends on the flow you import, and whether you use a Bench cluster:

    • When using a cluster, choose standard-small or standard-medium for the workspace master node

    • Otherwise, choose at least standard-large if you re-import a pipeline that originally came from nf-core, as they typically need 4 or more CPUs to run.

    • Select the "single user workspace" permissions (aka "Access limited to workspace owner "), which allows us to deploy pipelines

    The starting point is the analysis id that is used as pipeline validation test (the pipeline id is obtained from the analysis metadata).

    If no --analysis-id is provided, the tool lists all the successfull analyses in the current project and lets the developer pick one.

    • If conda and/or nextflow are not installed, pipeline-dev will offer to install them.

    • A folder called imported-flow-analysis is created.

    • Pipeline Nextflow assets are downloaded into the nextflow-src sub-folder.

    The following command runs this test profile. If a Bench cluster is active, it runs on your Bench cluster, otherwise it runs on the main workspace instance:

    When a pipeline is running on your Bench cluster, a few commands help to monitor the tasks and cluster. In another terminal, you can use:

    • qstat to see the tasks being pending or running

    • tail /data/logs/sge-scaler.log.<latest available workspace reboot time> to check if the cluster is scaling up or down (it currently takes 3 to 5 minutes to get a new node)

    • The output of the pipeline is in the outdir folder

    • Nextflow work files are under the work folder

    • Log files are .nextflow.log* and output.log

    Nextflow files (located in the nextflow-src folder) are easy to modify. Depending on your environment (ssh access / docker image with JupyterLab or VNC, with and without Visual Studio code), various source code editors can be used.

    After modifying the source code, you can run a validation iteration with the same command as before:

    Modifying the Docker image is the next step.

    Nextflow (and ICA) allow the Docker images to be specified at different places:

    • in config files such as nextflow-src/nextflow.config

    • in nextflow code files:

    grep container may help locate the correct files:

    Use case: Update some of the software (mimalloc) by compiling a new version

    With the appropriate permissions, you can then "docker login" and "docker push" the new image.

    With the appropriate permissions, you can then "docker login" and "docker push" the new image.

    Update the nextflow code and/or configs to use the new image

    Validate your changes in Bench:

    After generating a few ICA-specific files (JSON input specs for Flow launch UI + list of inputs for next step's validation launch), the tool identifies which previous versions of the same pipeline have already been deployed (in ICA Flow, pipeline versioning is done by including the version number in the pipeline name, so that's what is checked here).

    It then asks if we want to update the latest version or create a new one.

    At the end, the URL of the pipeline is displayed. If you are using a terminal that supports it, Ctrl+click or middle-click can open this URL in your browser.

    This launches an analysis in ICA Flow, using the same inputs as the pipeline's "test" profile.

    Some of the input files will have been copied to your ICA project to allow the launch to take place. They are stored in the folder /data/project/bench-pipeline-dev/temp-data.

    CWL CLI Pipeline Execution

    In this tutorial, we will demonstrate how to create and launch a pipeline using the CWL language with the Platform Core command line interface (CLI).

    Installation

    Please refer to these instructions for installing the Platform Core CLI.

    Tutorial project

    In this project, we will create two simple tools and build a pipeline that we can run on Platform Core using the CLI. The first tool (tool-fqTOfa.cwl) will convert a FASTQ file to a FASTA file. The second tool(tool-countLines.cwl) will count the number of lines in an input FASTA file. The workflow.cwl will combine the two tools to convert an input FASTQ file to a FASTA file and count the number of lines in the resulting FASTA file.

    Following are the two CWL tools and scripts we will use in the project. If you are new to CWL, please refer to the cwl user guide for a better understanding of CWL codes. You will also need the cwltool installed to create these tools and processes. You can find installation instructions on the CWL github page.

    tool-fqTOfa.cwl

    #!/usr/bin/env cwltool
    
    cwlVersion: v1.0
    class: CommandLineTool
    inputs:
      inputFastq:
        type: File
        inputBinding:
            position: 1
    stdout: test.fasta
    outputs:
      outputFasta:
        type: File
        streamable: true
        outputBinding:
            glob: test.fasta
    
    arguments:
    - 'NR%4 == 1 {print ">" substr($0, 2)}NR%4 == 2 {print}'
    baseCommand:
    - awk

    tool-countLines.cwl

    #!/usr/bin/env cwltool
    
    cwlVersion: v1.0
    class: CommandLineTool
    baseCommand: [wc, -l]
    inputs:
      inputFasta:
        type: File
        inputBinding:
            position: 1
    stdout: lineCount.tsv
    outputs:
      outputCount:
        type: File
        streamable: true
        outputBinding:
            glob: lineCount.tsv

    workflow.cwl

    cwlVersion: v1.0
    class: Workflow
    inputs:
      ipFQ: File
    
    outputs:
      count_out:
        type: File
        outputSource: count/outputCount
      fqTOfaOut:
        type: File
        outputSource: convert/outputFasta
       
    steps:
      convert:
        run: tool-fqTOfa.cwl
        in:
          inputFastq: ipFQ
        out: [outputFasta]
    
      count:
        run: tool-countLines.cwl
        in:
          inputFasta: convert/outputFasta
        out: [outputCount]

    we don't specify the Docker image used in both tools. In such a case, the default behaviour is to use public.ecr.aws/docker/library/bash:5 image. This image contains basic functionality (sufficient to execute wc and awk commands).

    If you want to use a different public image, you can specify it using requirements tag in cwl file. Assuming you want to use *ubuntu:latest' you need to add

    requirements:
      - class: DockerRequirement
        dockerPull: ubuntu:latest

    If you want to use a Docker image from the Platform Core Docker repository, you need the link to AWS ECR from the Platform Core GUI. Double-click on the image name in the Docker repository and copy the URL to the clipboard. Add the URL to dockerPull key.

    To add a custom or public docker image to the Platform Core repository, refer to the .

    Before you can use the Platform Core CLI, you need to authenticate using the Illumina API key. Follow to authenticate.

    Either create a project or use an existing project to create a new pipeline. You can create a new project using the icav2 projects create command.

    If you do not provide the --region flag, the value defaults to the existing region when there is only one region available. When there is more than one region available, a selection must be made from the available regions at the command prompt. The region input can be determined by calling the icav2 regions list command first.

    You can select the project to work on by entering the project using the icav2 projects enter command. Thus, you won't need to specify the project as an argument.

    You can also use the icav2 projects list command to determine the names and ids of the project you have access to.

    projectpipelines is the root command to perform actions on pipelines in a project. The create command creates a pipeline in the current project.

    The parameter file specifies the input with additional parameter settings for each step in the pipeline. In this tutorial, input is a FASTQ file shown inside <dataInput> tag in the parameter file. There aren't any specific settings for the pipeline steps resulting in a parameter file below with an empty <steps> tag. Create a parameter file (parameters.xml) with the following content using a text editor.

    The following command creates a pipeline called "cli-tutorial" using the workflow.cwl, tools "tool-fqTOfa.cwl" and "tool-countLines.cwl" and parameter file "parameter.xml" with small storage size.

    Once the pipeline is created, you can view it using the list command.

    Upload data to the project using the icav2 projectdata upload command. Refer to the for advanced data upload features. For this test, we will use a small FASTQ file test.fastq containing the following reads.

    The icav2 projectdata upload command lets you upload data to Platform Core.

    The list command lets you view the uploaded file. Note the ID of the file you want to use with the pipeline.

    The icav2 projectpipelines start command initiates the pipeline run. The following command runs the pipeline. Write down the id for exploring the analysis later.

    If for some reason your create command fails and needs to rerun, you might get an error (ConstraintViolationException). If so, try your command with a different name.

    You can check the status of the run using the icav2 projectanalyses get command.

    The pipelines can be run using JSON input type as well. The following is an example of running pipelines using JSON input type.

    runtime.ram and runtime.cpu values are by default evaluated using the compute environment running the host CWL runner. CommandLineTool Steps within a CWL pipeline run on different compute environments than the host CWL runner, so the valuations of the runtime.ram and runtime.cpu for within the CommandLineTool will not match the runtime environment the tool is running in. The valuation of runtime.ram and runtime.cpu can be overridden by specifying cpuMin and ramMin in the ResourceRequirements for the CommandLineTool.

    IAM Role Method

    To use the IAM Role method, you need to:

    • Set browser access to the S3 bucket (CORS).

    • Create data access permissions (IAM policy).

    • Configure storage credentials in Platform Core.

    • Create the and .

    • in Platform Core.

    • Verify S3 .

    • To use copy and move operations, you need to add the necessary policy statements in the S3 bucket policy.

    Optionally

    • It is best practice to to the S3 bucket.

    • If your bucket is KMS-enabled, follow the additional steps described .

    1

    Platform Core requires cross-origin resource sharing (CORS) permissions to write to the S3 bucket for uploads via the browser. Refer to (expand the Using the S3 console section) documentation for instructions on enabling CORS via the AWS Management Console.

    In the cross-origin resource sharing (CORS) section, enter the following content.

    2

    Platform Core requires specific permissions to access data in an AWS S3 bucket. These permissions are contained in an AWS IAM Policy.

    Object tags are copied when performing Copy, Move, Archive and Unarchive Operations within the same account or across accounts when using your own S3 storage.

    If there is an issue with copying, verify you have the required permission in your policies

    • In the configuration above, the s3:GetObjectTagging and s3:PutObjectTagging are part of the .

    • s3:GetObjectTagging and s3:PutObjectTagging are part of the .

    • For cross-account copy or move operations, s3:GetObjectTagging and s3:PutObjectTagging are included in the .

    The table below show some typical error situations and how to resolve them. After performing the configuration update suggested below, perform the validate action (System Settings > Storage > select your storage > Manage > Validate) to quickly see if this has resolved your issue.

    Error
    Possible Solution

    Tables

    All tables created within Base are gathered on the Projects > your_project > Base > Tables page. New tables can be created and existing tables can be updated or deleted here.

    To create a new table, click Projects > your_project > Base > Tables > +Create. Tables can be created from scratch or from a template that was previously saved. Views on data from Illumina hardware and processes are selected with the option .

    To create a table from scratch, complete the fields listed below and click the Save button. Once saved, a job will be created to create the table. To view table creation progress, navigate to the Activity page.

    The table name is a required field and must be unique. The first character of the table must be a letter followed by letters, numbers or underscores. The description is optional.

    Including or excluding references can be done by checking or un-checking the Include reference

    Bring Your Own Bench Image

    Bench images are Docker containers tailored to run in Platform Core with the necessary permissions, configuration and resources. For more information of Docker images, please refer to

    The following steps are needed to get your bench image running in Platform Core.

    You need to have Docker installed in order to build your images.

    For your Docker bench image to work in Platform Core, they must run on Linux X86 architecture, have the correct user id and initialization script in the Docker file.

    The following scripts must be part of your Docker bench image. Please refer to the examples from the for more details.

    This script copies the ica_start.sh

    If no threshold value is entered, no filter will be applied.
  • The filter affects both the plot and the table when the “Display only variants shown in the plot above” toggle is enabled.

  • Filter preferences persist across gene views for a seamless experience.

  • shows a stacked horizontal bar chart which displays molecular breakdown (disease type vs Gene) and subject count for the selected gene.

    When the Stop gained filter is applied, Stop lost variants will not appear in the plot or table if the "Display only variants shown in the plot above" toggle is enabled

    Create a Cohort

    launchPayload_inputFormValues.json (if not present, gets generated from the test profile): used by “pipeline-dev launch-validation-in-flow”.

    /data/project/pipeline-dev-files/temp
    .
  • get their Platform Core file IDs.

  • use these file ids in the launch specifications.

  • If remote files are used as validation inputs or as default input values of an input of type “file” (and not “string”): do the same as above.

  • Ask the user if they prefer to update the current version of the pipeline, create a new version, or enter a new name of their choice – or use the --create/--update parameters when specified, for scripting without user interactions.

    Currently only pipelines with publicly available Docker images are supported. Pipelines with Platform Core-stored images are not yet supported.

    here
    Updating an Existing Flow Pipeline
    website
    Connect an AWS S3 Bucket with SSE-KMS Encryption Enabled
    Bench (interactive data analysis)

    x

    View project resources

    x

    x

    x

    Link/Unlink data to a project

    x

    x

    Subscribe to notifications

    x

    x

    View Activity

    x

    x

    Create samples

    x

    x

    Delete/archive data

    x

    x

    Manage notification channels

    x

    Manage project team

    x

    x

    Create pipelines and tools

    x

    Edit pipelines and tools

    x

    Add docker image

    x

    x

    x

    Create queries

    x

    x

    Run queries

    x

    x

    Export query

    x

    x

    Save query

    x

    x

    Export tables

    x

    x

    Create tables

    x

    Load files into a table

    x

    x

    x

    Create/Delete/Modify workspaces

    x

    Install additional tools, packages, libraries, …

    x

    Build a new Bench docker image

    x

    Create a tool for pipeline-execution

    x

    Create a Connector

    x

    x

    View analyses results

    x

    x

    Create analyses

    View table records

    x

    x

    Click on links in table

    Execute a notebook

    x

    x

    Start/Stop Workspace

    Email invites are sent out as soon as you click the save button on the add team member dialog.

    Project Owner

    Roles

    If a user has been added both as member of a workgroup and as individual user, then the individual rights supersede the group rights. This way, you can add all users in a workgroup and change access for individual users when needed, regardless of their workgroup rights.

    Upload and Download rights

    Upload and download rights are independent of the assigned role. A user with only viewer rights will still be able to perform uploads and downloads if their upload and download rights are not disabled. Likewise, an administrator can only perform uploads and downloads if their upload and download rights are enabled.

    Project Access

    Flow Access

    Base Access

    Bench Access

    Project
    Flow
    Base

    x

    Specify at least 100GB of disk space

  • Optional: After choosing the image, enable a cluster with at least one standard-large instance type.

  • Start the workspace, then (if applicable) also start the cluster

  • Pipeline input form and associated javascript are downloaded into the ica-flow-config sub-folder.

  • Analysis input specs are downloaded to the ica-flow-config/launchPayload_inputFormValues.json file.

  • The analysis inputs are converted into a "test" profile for Nextflow, stored - among other items - in nextflow_bench.conf

  • Preparation

    Start Bench Workspace

    Import Existing Pipeline and Analysis to Bench

    Results

    Run Validation Test in Bench

    The pipeline-dev tool is using "nextflow run ..." to run the pipeline. The full nextflow command is printed on stdout and can be copy-pasted+adjusted if you need additional options.

    Monitoring

    Data Locations

    Modify Pipeline

    Identify Docker Image

    Docker Image Update: Dockerfile Method

    Docker Image Update: Interactive Method

    Fun fact: VScode with the "Dev Containers" extension lets you edit the files inside your running container:

    Beware that this extension creates a lot of temp files in /tmp and in $HOME/.vscode-server. Don't include them in your image...

    Deploy as Flow Pipeline

    Result

    Run Validation Test in Flow

    Result

    monitor
    modify pipeline code
    nextflow
    Dockerfile
    Interactive
    redeploy pipeline to ICA Flow
    launch Flow validation test from Bench

    Authentication

    Enter/Create a Project

    Create a pipeline on Platform Core

    Running the pipeline

    JSON input works only with file-based CWL pipelines built using code, not a graphical editor in Platform Core.

    Notes

    runtime.ram and runtime.cpu

    Docker Repository
    these instructions
    Data page
    mkdir demo-flow-dev
    cd demo-flow-dev
     
    pipeline-dev import-from-flow
     or
    pipeline-dev import-from-flow --analysis-id=9415d7ff-1757-4e74-97d1-86b47b29fb8f
    Enter the number of the entry you want to use: 21
    Fetching analysis 9415d7ff-1757-4e74-97d1-86b47b29fb8f ...
    Fetching pipeline bb47d612-5906-4d5a-922e-541262c966df ...
    Fetching pipeline files... main.nf
    Fetching test inputs
    New Json inputs detected
    Resolving test input ids to /data/mounts/project paths
    Fetching input form..
    Pipeline "GWAS pipeline_1.
    _2_1_20241215_130117" successfully imported.
    pipeline name: GWAS pipeline_1_2_1_20241215_130117 
    analysis name: Test GWAS pipeline_1_2_1_20241215_130117 
    pipeline id : bb47d612-5906-4d5a-922e-541262c966df
    analysis id : 9415d7ff-1757-4e74-97d1-86b47b29fb8f
    Suggested actions:
    pipeline-dev run-in-bench 
    I Iterative dev: Make code changes + re-validate with previous command ] 
    pipeline-dev deploy-as-flow-pipeline
    pipeline-dev run-in-flow
    cd imported-flow-analysis
    pipeline-dev run-in-bench
    /data/demo $ tail /data/logs/sge-scaler.log.*
    2025-02-10 18:27:19,657 - SGEScaler - INFO: SGE Marked Overview - {'UNKNOWN': O, 'DEAD': O, 'IDLE': O, 'DISABLED': O, 'DELETED': O, 'UNRESPONSIVE': 0}
    2025-02-10 18:27:19,657 - SGEScaler - INFO: Job Status - Active jobs : 0, Pending jobs : 6
    2025-02-10 18:27:26,291 - SGEScaler - INFO: Cluster Status - State: Transitioning,
    Online Members: 0, Offline Members: 2, Requested Members: 2, Min Members: 0, Max Members: 2
    code nextflow-src # Open in Visual Studio Code
    code .            # Open current dir in Visual Studio Code
    vi nextflow-src/main.nf
    pipeline-dev run-in-bench
    /data/demo-flow-dev $ head nextflow-src/main.nf
    nextflow.enable.dsl = 2
    process top_level_process t
    container 'docker.io/ljanin/gwas-pipeline:1.2.1'
    IMAGE_BEFORE=docker.io/ljanin/gwas-pipeline:1.2.1
    IMAGE_AFTER=docker.io/ljanin/gwas-pipeline:tmpdemo
     
    # Create directory for Dockerfile
    mkdir dirForDockerfile
    cd dirForDockerfile
    
    # Create Dockerfile
    cat <<EOF > Dockerfile
    FROM ${IMAGE_BEFORE}
    RUN mkdir /mimalloc-compile \
     && cd /mimalloc-compile \
     && git clone -b v2.0.6 https://github.com/microsoft/mimalloc \
     && mkdir -p mimalloc/out/release \
     && cd mimalloc/out/release \
     && cmake ../.. \
     && make \
     && make install \
     && cd / \
     && rm -rf mimalloc-compile
    EOF
    
    # Build image
    docker build -t ${IMAGE_AFTER} .
    IMAGE_BEFORE=docker.io/ljanin/gwas-pipeline:1.2.1
    IMAGE_AFTER=docker.io/ljanin/gwas-pipeline:1.2.2
    docker run -it --rm ${IMAGE_BEFORE} bash
     
    # Make some modifications
    vi /scripts/plot_manhattan.py
    <Fix "manhatten.png" into "manhattAn.png">
    <Enter :wq to save and quit vi>
    <Start another terminal (try Ctrl+Shift+T if using wezterm)>
    # Identify container id
    # Save container changes into new image layer
    CONTAINER_ID=c18670335247
    docker commit ${CONTAINER_ID} ${IMAGE_AFTER}
    sed --in-place "s/${IMAGE_BEFORE}/${IMAGE_AFTER}/" nextflow-src/main.nf
    pipeline-dev run-in-bench
    pipeline-dev deploy-as-flow-pipeline
    Choice: 2
    Creating ICA Flow pipeline dev-nf-core-demo_v4
    Sending inputForm.json
    Sending onRender.js
    Sending main.nf
    Sending nextflow.config
    /data/demo $ pipeline-dev deploy-as-flow-pipeline
    
    Generating ICA input specs...
    Extracting nf-core test inputs...
    Deploying project nf-core/demo
    - Currently being developed as: dev-nf-core-demo
    - Last version updated in ICA:  dev-nf-core-demo_v3
    - Next suggested version:       dev-nf-core-demo_v4
    
    How would you like to deploy?
    1. Update dev-nf-core-demo (current version)
    2. Create dev-nf-core-demo_v4
    3. Enter new name
    4. Update dev-nf-core-demo_v3 (latest version updated in ICA)
    Sending docs/images/nf-core-demo-subway.svg
    Sending docs/images/nf-core-demo_logo_dark.png
    Sending docs/images/nf-core-demo_logo_light.png
    Sending docs/images/nf-core-demo-subway.png
    Sending docs/README. md
    Sending docs/output.md
    
    Pipeline successfully deployed
    - Id : 26bc5aa5-0218-4e79-8a63-ee92954c6cd9
    - URL: https://stage.v2.stratus.illumina.com/ica/projects/1873043/pipelines/26bc5aa5-0218-4e79-8a63-ee92954C6cd9
    
    Suggested actions:
      pipeline-dev run-in-flow
    pipeline-dev launch-validation-in-flow
    /data/demo $ pipeline-dev launch-validation-in-flow
    
    pipelineld: 26bc5aa5-0218-4e79-8a63-ee92954c6cd9
    Getting Analysis Storage Id
    Launching as ICA Flow Analysis...
    
    ICA Analysis created:
    - Name: Test dev-nf-core-demo_v4
    - Id:   cadcee73-d975-435d-b321-5d60e9aec1ec
    - Url:   https://stage.v2.stratus.illumina.com/ica/projects/1873043/analyses/cadcee73-d975-435d-b321-5d60e9aec1ec
    requirements:
      - class: DockerRequirement
        dockerPull: 079623148045.dkr.ecr.eu-central-1.amazonaws.com/cp-prod/XXXXXXXXXX:latest
    % icav2 projects create basic-cli-tutorial --region c39b1feb-3e94-4440-805e-45e0c76462bf
    % icav2 projects enter basic-cli-tutorial
    % icav2 projects list
    <?xml version="1.0" encoding="UTF-8" standalone="yes"?>
    <pd:pipeline xmlns:pd="xsd://www.illumina.com/ica/cp/pipelinedefinition" code="" version="1.0">
        <pd:dataInputs>
            <pd:dataInput code="ipFQ" format="FASTQ" type="FILE" required="true" multiValue="false">
                <pd:label>ipFQ</pd:label>
                <pd:description></pd:description>
            </pd:dataInput>
        </pd:dataInputs>
        <pd:steps/>
    </pd:pipeline>
    % icav2 projectpipelines create cwl cli-tutorial --workflow workflow.cwl --tool tool-fqTOfa.cwl --tool tool-countLines.cwl --parameter parameters.xml --storage-size small --description "cli tutorial pipeline"
    % icav2 projectpipelines list
    ID                                   	CODE                      	DESCRIPTION                                      
    6779fa3b-e2bc-42cb-8396-32acee8b6338	cli-tutorial             	cli tutorial pipeline 
    @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
    AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
    +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
    IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
    @SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
    AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
    +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
    IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
    @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
    AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
    +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
    IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
    @SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
    AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
    +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
    IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
    @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
    AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
    +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
    IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
    @SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
    AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
    +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
    IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
    % icav2 projectdata upload test.fastq /
    oldFilename= test.fastq en newFilename= test.fastq
    bucket= stratus-gds-use1  prefix= 0a488bb2-578b-404a-e09d-08d9e3343b2b/test.fastq
    Using: 1 workers to upload 1 files
    15:23:32: [0]  Uploading /Users/user1/Documents/icav2_validation/for_tutorial/working/test.fastq
    15:23:33: [0]  Uploaded /Users/user1/Documents/icav2_validation/for_tutorial/working/test.fastq to /test.fastq in 794.511591ms
    Finished uploading 1 files in 795.244677ms
    
    % icav2 projectdata list                
    PATH          NAME        TYPE  STATUS    ID                                    OWNER                                 
    /test.fastq  test.fastq FILE  AVAILABLE fil.c23246bd7692499724fe08da020b1014  4b197387-e692-4a78-9304-c7f73ad75e44
    % icav2 projectpipelines start cwl cli-tutorial --type-input STRUCTURED --input ipFQ:fil.c23246bd7692499724fe08da020b1014 --user-reference tut-test
    analysisStorage.description           1.2 TB
    analysisStorage.id                    6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
    analysisStorage.name                  Small
    analysisStorage.ownerId               8ec463f6-1acb-341b-b321-043c39d8716a
    analysisStorage.tenantId              f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
    analysisStorage.tenantName            ica-cp-admin
    analysisStorage.timeCreated           2021-11-05T10:28:20Z
    analysisStorage.timeModified          2021-11-05T10:28:20Z
    id                                    461d3924-52a8-45ef-ab62-8b2a29621021
    ownerId                               7fa2b641-1db4-3f81-866a-8003aa9e0818
    pipeline.analysisStorage.description  1.2 TB
    pipeline.analysisStorage.id           6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
    pipeline.analysisStorage.name         Small
    pipeline.analysisStorage.ownerId      8ec463f6-1acb-341b-b321-043c39d8716a
    pipeline.analysisStorage.tenantId     f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
    pipeline.analysisStorage.tenantName   ica-cp-admin
    pipeline.analysisStorage.timeCreated  2021-11-05T10:28:20Z
    pipeline.analysisStorage.timeModified 2021-11-05T10:28:20Z
    pipeline.code                         cli-tutorial
    pipeline.description                  Test, prepared parameters file from working GUI
    pipeline.id                           6779fa3b-e2bc-42cb-8396-32acee8b6338
    pipeline.language                     CWL
    pipeline.ownerId                      7fa2b641-1db4-3f81-866a-8003aa9e0818
    pipeline.tenantId                     d0696494-6a7b-4c81-804d-87bda2d47279
    pipeline.tenantName                   icav2-entprod
    pipeline.timeCreated                  2022-03-10T13:13:05Z
    pipeline.timeModified                 2022-03-10T13:13:05Z
    reference                             tut-test-cli-tutorial-eda7ee7a-8c65-4c0f-bed4-f6c2d21119e6
    status                                REQUESTED
    summary                               
    tenantId                              d0696494-6a7b-4c81-804d-87bda2d47279
    tenantName                            icav2-entprod
    timeCreated                           2022-03-10T20:42:42Z
    timeModified                          2022-03-10T20:42:43Z
    userReference                         tut-test
    %   icav2 projectanalyses get 461d3924-52a8-45ef-ab62-8b2a29621021
    analysisStorage.description           1.2 TB
    analysisStorage.id                    6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
    analysisStorage.name                  Small
    analysisStorage.ownerId               8ec463f6-1acb-341b-b321-043c39d8716a
    analysisStorage.tenantId              f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
    analysisStorage.tenantName            ica-cp-admin
    analysisStorage.timeCreated           2021-11-05T10:28:20Z
    analysisStorage.timeModified          2021-11-05T10:28:20Z
    endDate                               2022-03-10T21:00:33Z
    id                                    461d3924-52a8-45ef-ab62-8b2a29621021
    ownerId                               7fa2b641-1db4-3f81-866a-8003aa9e0818
    pipeline.analysisStorage.description  1.2 TB
    pipeline.analysisStorage.id           6e1b6c8f-f913-48b2-9bd0-7fc13eda0fd0
    pipeline.analysisStorage.name         Small
    pipeline.analysisStorage.ownerId      8ec463f6-1acb-341b-b321-043c39d8716a
    pipeline.analysisStorage.tenantId     f91bb1a0-c55f-4bce-8014-b2e60c0ec7d3
    pipeline.analysisStorage.tenantName   ica-cp-admin
    pipeline.analysisStorage.timeCreated  2021-11-05T10:28:20Z
    pipeline.analysisStorage.timeModified 2021-11-05T10:28:20Z
    pipeline.code                         cli-tutorial
    pipeline.description                  Test, prepared parameters file from working GUI
    pipeline.id                           6779fa3b-e2bc-42cb-8396-32acee8b6338
    pipeline.language                     CWL
    pipeline.ownerId                      7fa2b641-1db4-3f81-866a-8003aa9e0818
    pipeline.tenantId                     d0696494-6a7b-4c81-804d-87bda2d47279
    pipeline.tenantName                   icav2-entprod
    pipeline.timeCreated                  2022-03-10T13:13:05Z
    pipeline.timeModified                 2022-03-10T13:13:05Z
    reference                             tut-test-cli-tutorial-eda7ee7a-8c65-4c0f-bed4-f6c2d21119e6
    startDate                             2022-03-10T20:42:42Z
    status                                SUCCEEDED
    summary                               
    tenantId                              d0696494-6a7b-4c81-804d-87bda2d47279
    tenantName                            icav2-entprod
    timeCreated                           2022-03-10T20:42:42Z
    timeModified                          2022-03-10T21:00:33Z
    userReference                         tut-test
     % icav2 projectpipelines start cwl cli-tutorial --data-id fil.c23246bd7692499724fe08da020b1014 --input-json '{
      "ipFQ": {
        "class": "File",
        "path": "test.fastq"
      }
    }' --type-input JSON --user-reference tut-test-json
    Refer to the Creating policies on the JSON tab documentation for instructions on creating an AWS IAM Policy via the AWS Management Console (on AWS go to IAM > Policies > create policy). Use the configuration below during the process, tab one shows the code for unversioned buckets, tab two the code for versioned and versioning-suspended buckets.

    Paste the JSON policy document below. Note the example below provides access to all object prefixes in the bucket.

    Replace <YOUR_BUCKET_NAME> with the name of the S3 bucket you created for Platform Core. Replace <YOUR_FOLDER_NAME> with the name of the folder in your S3 bucket.

    {
        "Version": "
    

    On Versioned OR Suspended buckets, paste the JSON policy document below. Note the example below provides access to all objects prefixes in the bucket.

    Replace YOUR_BUCKET_NAME with the name of the S3 bucket you created for Platform Core. Replace YOUR_FOLDER_NAME with the name of the folder in your S3 bucket.

    {
        "Version": "2012-10-17",
        "Statement": [
            {
                "Effect": "Allow",
                "Action": [
                    "s3:PutBucketNotification",
                    "s3:ListBucket",
                    "s3:GetBucketNotification",
                    "s3:GetBucketLocation",
                    "s3:ListBucketVersions",
                    "s3:GetBucketVersioning"
                ],
                "Resource": [
                    "arn:aws:s3:::<YOUR_BUCKET_NAME>"
                ]
            },
            {
                "Effect": "Allow",
                "Action": [
                    "s3:PutObject",
                    "s3:GetObject",
                    "s3:RestoreObject",
                    "s3:DeleteObject",
                    "s3:DeleteObjectVersion",
                    "s3:GetObjectVersion",
                    "s3:GetObjectTagging",
                    "s3:PutObjectTagging",
                    "s3:GetObjectVersionTagging",
                    "s3:PutObjectVersionTagging"
                ],
                "Resource": "arn:aws:s3:::<YOUR_BUCKET_NAME>/<YOUR_FOLDER_NAME>/*"
            },
            {
                "Effect": "Allow",
                "Action": [
                    "sts:GetFederationToken"
                ],
                "Resource": [
                    "*"
                ]
            }
        ]
    }

    To create the IAM Policy via the AWS CLI, create a local file named illumina-core-admin-policy.json containing the policy content above and run the following command. Be sure the path to the policy document (--policy-document) leads to the path where you saved the file:

    3

    Create Platform Core Storage Credential

    Storage Credential

    To connect your S3 account to Platform Core, you need to add a storage credential in Platform Core which will generate the RoleSessionName prefix.

    From the Platform Core home screen, navigate to System Settings > Credentials > Create > Storage Credential to create a new storage credential.

    1. Select AWS_Role as type and provide a name for the storage credential.

    2. Choose Generate to create the RoleSessionName prefix. Once generated, you can download it with the Download to Excel button or copy and paste it by unmasking the prefix with the eye symbol on the right. You will need this RoleSessionName in the next step.

    Once the storage credentials are present, create a storage configuration using the credential. Refer to for details.

    4

    Create AWS IAM Role

    You need to create the IAM role which Platform Core will assume to access your S3 bucket. See this AWS documentation for instructions on creating an AWS IAM Role via the AWS Management Console. This Role will allow to delegate permissions to Platform Core to connect to your S3 storage for the required duration.

    Open your IAM console and perform the steps below:

    1. Copy the Trust Policy below to an editor and update the following values:

      • <your AWS client account number> is your actual .

      • <region-alias> must be taken from the below. For example, us-east-1 for United States.

      • <OIDC provider ID> must be taken from the below. For example 10FBA7EDEB5930CCFC300EF5AC3DB2FE for United States

      • <namespace> must be taken from the below. For example, use1 for United States.

      • <session name prefix> must be replaced with the session name prefix value generated in the previous step, . Keep the -* at the end. This prefix works as an proof of identity for the requesting process and ensures the role can only be granted if the requesting process provides a session name starting with this prefix. If a process with a different session name prefix requests the role, it will be automatically denied. This is an additional layer of security.

    2. Choose Roles > Create role and choose Custom Trust Policy.

    3. Paste the edited Trust Policy.

    4. Select the Permission Policy created in .

    5. Give your role a name to indicate what it is to be used for (for example Illumina_Core_Role) and preferably a description so other users will know what the IAM role will be used for.

    6. Click create to create the role.

    7. Open your created role and choose Edit (top right) to set the role time to 12 hours instead of the default 1 hour.

    1. Copy the ARN from your created role summary as this will be needed in the in Platform Core

    Region Name
    OIDC provider ID
    OIDC Provider ARN
    Region Alias
    Namespace
    5

    Create OpenID Connect (OIDC) Identity Provider

    An OpenID Connect identity provider is a trusted resource that provides identity tokens. This allows AWS to know which external identities are allowed to obtain the temporary roles. Here you connect your regional Platform Core instance so it can obtain the required role to access your storage. For more information on OIDC providers, see OIDC entity providers on AWS.

    Open your IAM console and perform the steps below:

    • Under IAM > Identity Providers > Add provider.

    • Select OpenID Connect as provider and enter the Provider URL which matches your Platform Core/S3 location from the below.

    • For Audience, enter sts.amazonaws.com and click on Add Provider.

    • Verify that the arn from the newly created OIDC provider matches the arn from the above.

    See below for an example of how the OIDC provider and IAM role Trusted entities look

    Region
    OIDC Provider URL
    6

    S3 Bucket Policy

    Connecting your S3 bucket to Platform Core does not require any additional bucket policies.

    What if you need a bucket policy for use cases beyond Platform Core?

    The bucket policy must then support the essential permissions needed by Platform Core without inadvertently restricting its functionality.

    In this example, restriction is enabled on the bucket policy to prevent any kind of access to the bucket. However, there is an exception rule added for the IAM role that Platform Core is using to connect to the S3 bucket. The exception rule is allowing Platform Core to perform the above S3 action permissions necessary for Platform Core functionalities.

    Additionally, the exception rule is applied to the STS federated user session principal associated with Platform Core. Since Platform Core leverages the AWS STS to provide temporary credentials that allow users to perform actions on the S3 bucket, it is crucial to include these STS federated user session principals in your policy's whitelist. Failing to do so could result in 403 Forbidden errors when users attempt to interact with the bucket's objects using the provided temporary credentials.

    7

    S3 Object Ownership

    Verify that the bucket's Object Ownership is set to ACLs disabled (Bucket owner enforced) on the Permissions tab. This is the AWS-recommended default for new buckets.

    If it is not correctly set, open your bucket In the AWS S3 console, go to the Permissions tab, find Object Ownership, choose Edit, select ACLs disabled (recommended), and save.

    When Illumina copies data into your bucket, the objects are written by an Illumina service identity. If your bucket has ACLs enabled (Bucket owner preferred), those copied objects remain owned by the writer rather than by your bucket, and Illumina's processing is then unable to read them back, which causes copy jobs to stall or fail with an access-denied (403) error. Setting Object Ownership to ACLs disabled (Bucket owner enforced) ensures your account always owns every object in the bucket, so the data can be read and processed normally.

    Object Ownership is not the same as the Bucket Policy

    Object Ownership and Bucket Policy are two separate settings on an S3 bucket:

    • Bucket Policy is the JSON document that grants Illumina access to your bucket.

    8

    Block Public Access to S3 bucket (optional)

    By default, public access to the S3 bucket is allowed. For increased security, it is advised to block public access with the command below. Change <YOUR_BUCKET_NAME> to the name of your S3 bucket.

    aws s3api put-public-access-block --bucket <YOUR_BUCKET_NAME> --public-access-block-configuration "BlockPublicAcls=true,IgnorePublicAcls=true,BlockPublicPolicy=true,RestrictPublicBuckets=true"

    To block public access to S3 buckets on account level, you can use the AWS Console on the Amazon Web Services website.

    9

    Enabling Cross-Account Access for Copy and Move Operations

    When setting up cross-account access, ensure that no are blocking the required permissions

    Platform Core uses AssumeRole to copy and move objects from a bucket in an AWS account to another bucket in another AWS account. To allow cross account access to a bucket, the following policy statements must be added in the S3 bucket policy (tab one below shows the code for unversioned buckets, tab two the code for versioned and versioning-suspended buckets.)

    Be sure to replace the following fields:

    • <ASSUME_ROLE_ARN>: Replace this field with the ARN of the cross account role you want to give permission to. Refer to the table below to determine which region-specific Role ARN should be used.

      {
            "Version": "
    
      {
            "Version": "2012-10-17",
            "Statement": [
                {
                    "Sid": "AllowCrossAccountAccess",
                    "Effect": "Allow",
                    "Principal": {
                        "AWS": "<ASSUME_ROLE_ARN>"
                    },
                    "Action": [
                        "s3:PutObject",
                        "s3:DeleteObject",
                        "s3:ListMultipartUploadParts",
                        "s3:AbortMultipartUpload",
                        "s3:GetObject",
                        "s3:GetObjectVersion",
                        "s3:DeleteObjectVersion",
                        "s3:GetObjectTagging",
                        "s3:PutObjectTagging",
                        "s3:GetObjectVersionTagging",
                        "s3:PutObjectVersionTagging"
                    ],
                    "Resource": [
                        "arn:aws:s3:::<YOUR_BUCKET_NAME>",
                        "arn:aws:s3:::<YOUR_BUCKET_NAME>/*"
                    ]
                }
            ]
        }

    The ARN of the cross account role you want to give permission to is specified in the Principal. Refer to the table below to determine which region-specific Role ARN should be used.

    Region
    Role ARN

    Before copy and move operations are executed on your own S3 storage, a test is performed to verify the necessary operational rights. This can result in temporary test files remaining (for example when is not correctly set up for a versioned bucket). These files can safely be manually deleted from your S3 console.

    [
        {
            "AllowedHeaders": [
                "*"
            ],
            "AllowedMethods": [
                "HEAD",
                "GET",
                "PUT",
                "POST",
                "DELETE"
            ],
            "AllowedOrigins": [
                "https://ica.illumina.com"
            ],
            "ExposeHeaders": [
                "ETag",
                "x-amz-meta-custom-header"
            ]
        }
    ]

    GetTempraryCredentaislAsync Failed with STS error

    Not Authorized to perform sts:AssumeRoleWithWebIdentity can indicate an error in the address of the service account that issued the token. Please verify the line "oidc.eks.<region-alias>.amazonaws.com/id/<OIDC Provider ID>:sub": "system:serviceaccount:<namespace>:irsa-<namespace>-gds*", for errors in the namespace of your IAM Role.

    Invalid Role Session Duration Set Maximum session Duration to 12 hours.

    This error indicates an incorrect IAM Role session duration. By default it is 1 hour, but It must be set to 12 hours.

    Access Forbidden not authorized to perform s3:GetBucketLocation

    If the cause is no identity-based policy allows the s3:GetBucketLocation action, the issue might be that the permission policy attached to your role does not point to the correct bucket. Please verify the line "Resource": ["arn:aws:s3:::YOUR_BUCKET_NAME"] has the correct bucket name in the IAM Policy

    Configure Bucket CORS Permission

    Create Data Access Permission - AWS IAM Policy

    Permissions

    Copying Object Tags

    burst-new

    Storage configurations created in Platform Core 2.47 or later automatically have object tag copying included.

    For storage configurations created prior to Platform Core v2.47, object tag copying is optional. If you want to enable it, contact Illumina support to enable TaggingPermissionType on the Platform Core Storage Configuration record associated with the S3 bucket with Object tags.

    Troubleshooting

    IAM role
    OIDC provider
    Create a storage configuration
    Object Ownership
    block public access
    here
    Configuring cross-origin resource sharing (CORS)
    IAM Policy
    S3 Bucket policy
    cross-account access bucket policy
    aws iam create-policy --policy-name illumina-core-admin-policy --policy-document file://illumina-core-admin-policy.json

    If you get the error "no identity-based policy allows the s3:PutObject action", verify that in the expression above:

    • (line 13) "arn:aws:s3:::<YOUR_BUCKET_NAME>" matches the first part of

    • (line 26) "arn:aws:s3:::<YOUR_BUCKET_NAME>/<YOUR_FOLDER_NAME>/*"

    (Optional) Set policy name to "illumina-core-admin-policy"

    checkbox. These reference fields are not shown on the table creation page, but are added to the schema definition, which is visible after creating the table (
    Projects > your_project > Base > Tables > your_table > Schema definition)
    . By including references, additional columns will be added to the
    containing references to the data on the platform:
    Reference
    Originating source object reference in the Illumina platform.

    data_name

    Original name of the data element, for example the filename.

    data_reference

    Reference to the data element (for example, the file id which you can see at Projects > your_project > Data > your_file > Data details).

    execution_reference

    In an empty table, you can create a schema by adding a field with the +Add button for each column of the table and defining it. At any time during the creation process, it is possible to switch to the edit definition mode and back. The definition mode shows the JSON code, whereas the original view shows the fields in a table.

    Each field requires:

    • a unique name (*1) with optional description.

    • a type

      • String – collection of characters

      • Bytes – raw binary data

      • Integer – whole numbers

      • Float – fractional numbers (*2)

      • Numeric – any number (*3)

      • Boolean – only options are “true” or “false”

      • Timestamp - Stores number of (milli)seconds passed since the Unix epoch

      • Date - Stores date in the format YYYY-MM-DD

      • Time - Stores time in the format HH:MI:SS

      • Datetime - Stores date and time information in the format YYYY-MM-DD HH:MI:SS

      • Record – has a child field

      • Variant - can store a value of any other type, including OBJECT and ARRAY

    • a mode

      • Required - Mandatory field

      • Nullable - Field is allowed to have no value

      • Repeated - Multiple values are allowed in this field (will be recognized as array in Snowflake)

    Users can create their own template by making a table which is turned into a template at Projects > your_project > Base > Tables > your_table > Manage (top right) > Save as template.

    If a template is created and available/active, it is possible to create a new table based on this template. The table information and references follow the rules of the empty table but in this case the schema will be pre-filled. It is possible to still edit the schema that is based on the template.

    The status of a table can be found at Projects > your_project > Base > Tables. The possible statuses are:

    • Available: Ready to be used, both with or without data

    • Pending: The system is still processing the table, there is probably a process running to fill the table with data

    • Deleted: The table is deleted functionally; it still exists and can be shown in the list again by clicking the Show deleted tables/views button

    Additional Considerations

    • Tables created from empty data or from a template are available faster.

    • When copying a table with data, it can remain in a Pending for longer periods of time.

    • Clicking on the page's refresh button will update the list.

    For any available table, the following details are shown:

    • Table information: Name, description, status, number of records and data size.

    • Definition: An overview of the table schema, also available in text. Fields can be added to the schema but not deleted. Tip for deleting fields: copy the schema as text and paste in a new empty table where the schema is still editable.

    • Preview: A preview of the table for the 50 first rows (when data is uploaded into the table). Select show details to see record details.

    • Source Data: the files that are currently uploaded into the table. You can see the Load Status of the files which can be Prepare Started, Prepare Succeeded or Prepare Failed and finally Load Succeeded or Load Failed.

    From within the details of a table it is possible to perform the following actions from the Manage menu (top right) of the table:

    • Edit: Add fields to the table and change the table description.

    • Copy: Create a copy from this table in the same or a different project. In order to copy to another project, data sharing of the original project should be enabled in the details of this project. The user also has to have access to both original and target project.

    • Export as file: Export this table as a CSV or JSON file. The exported file can be found in a project where the user has the access to download it.

    • Save as template: Save the schema or an edited form of it as a template.

    • Add data: Load additional data into the table manually. This can be done by selecting data files previously uploaded to the project, or by dragging and dropping files directly into the popup window for adding data to the table. It’s also possible to load data into a table manually or automatically via a pre-configured job. This can be done on the Schedule page.

    • Delete: Delete the table.

    To manually add data to your table, go to Projects > your_project > Base > Tables > your_table > Manage (top right) > Add Data

    The data selection screen will show options to select the structure as CSV (comma-separated), TSV (tab-separated) or JSON (JavaScript Object Notation) and the location of your source data. In the first step, you select the data format and the files containing the data.

    Data format (required)

    Select the format of the data which you want to import. This will also serve as filter to help you select files of this type.

    Write preference

    Define if data can be written to the table only when the table is empty, if the data should be appended to the table or if the table should be overwritten.

    Delimiter

    Which delimiter is used in the delimiter separated file. If the required delimiter is not comma, tab or pipe, select custom and define the custom delimiter.

    Custom delimiter

    If a custom delimiter is used in the source data, it must be defined here.

    To see the status of your data import, go to Projects > your_project > Activity > Base Jobs where you will see a job of type Prepare Data which will have succeeded or failed. If it has failed, you can see the error message and details by double-clicking the base job. You can then take corrective actions if the input mismatched with the table design and try to run the import again (with a new copy of the file as each input file can only be used once)

    If you need to cancel the import, you can do so while it is scheduled by navigating to the Base Jobs inventory and selecting the job followed by Abort.

    To see which data has been used to populate your table go to Projects > your_project > Base > Tables > your_table > Source Data. This will list all the source data files, including those that failed to be imported. You can not use these files anymore to import again to prevent double entries. The load status will remain empty while the data is being processed and be set to load succeeded or failed after loading completes.

    Base Table schema definitions do not include an array type, but arrays can be ingested using either the Repeated mode for arrays containing a single type (ie, String), or the Variant type.

    If you have a nested JSON structure, you can import it into individual fields of your table.

    For example, if your JSON nested structure looks like the above and you want to get it imported into a table with a, b and c having integers as values, you need to create a matching table. This can be done either manually or via the sql command CREATE OR REPLACE TABLE json_data ( a INTEGER, b INTEGER, c INTEGER);

    Format your JSON data to have single lines per structure.

    Finally, create a schedule to import your data or perform a manual import.

    The resulting table will look like this:

    #
    A
    B
    C

    1

    1

    1

    2

    Create a new Table

    Caution

    Once a table is saved it is no longer possible to edit the schema, only new fields can be added. The workaround is switching to text mode, copying the schema of the table to which you want to make modifications and paste it into a new empty table where the necessary changes can be made before saving.

    Once created, do not try to modify your table column layout via the Query module as even though you can execute ALTER TABLE commands, the definitions and syntax of the table will go out of sync resulting in processing issues.

    Empty Table

    Table information

    References

    Import from catalogue
    {
        "one": {
          "a": "1",
          "b": "1"
        },
        "three": {
          "a": "3",
          "b": "3",
          "c": "3"
        }
    }
    {"A":1,"B":1}
    {"A":3,"B":3,"C":3}

    Schema

    If you make a mistake in the order of columns when creating your table, then as long as you have not saved your table, you can switch to Edit definition to change the column order. The text editor can swap or move columns whereas the built-in editor can only delete columns or add columns to the end of the sequence. When editing in text mode, it is best practice to copy the content of the text editor to a notepad before you make changes because a corrupted syntax will result in the text being wiped or reverted when switching between text and non-text mode.

    (*1) Do not use reserved Snowflake keywords such as left, right, sample, select, table,... (https://docs.snowflake.com/en/sql-reference/reserved-keywords) for your schema name as this will lead to SQL compilation errors.

    (*2) Float values will be exported differently depending on the output format. For example JSON will use scientific notation so verify that your consecutive processing methods support this.

    (*3) Defining the precision when creating tables with SQL is not supported as this will result in rounding issues.

    From template

    Table information

    Table status

    Table details

    The data size of tables with the same layout and content may vary slightly, depending on when and how the data was written by Snowflake.

    Table actions

    Manually importing data to your Table

    Data selection

    Most of the advanced options are legacy functions and should not be used. The only exceptions are

    • Encoding: Select if the encoding is UTF-8 (any Unicode character) or ISO-8859-1 (first 256 Unicode characters).

    • Ignore unknown values: This applies to CSV-formatted files. You can use this function to handle optional fields without separators, provided that the missing fields are located at the end of the row. Otherwise, the parser can not detect the missing separator and will shift fields to the left, resulting in errors.

    Data import progress

    List of table data sources

    How to load array data in Base

    Parsing nested JSON data

    schema
    file which takes care of the Initialization and termination of your workspace to the location in your project from where it can be started by Platform Core when you request to start your workspace.

    The user settings must be set up so that bench runs with UID 1000.

    To do a clean shutdown, you can capture the sigterm which is transmitted 30 seconds before the workspace is terminated.

    Once you have Docker installed and completed the configuration of your Docker files, you can build your bench image.

    1. Open the command prompt on your machine.

    2. Navigate to the root folder of your Docker files.

    3. Execute docker build -f Dockerfile -t mybenchimage:0.0.1 . with mybenchimage being the name you want to give to your image and 0.0.1 replaced with the version number which you want your bench image to be. For more information on this command, see https://docs.docker.com/reference/cli/docker/buildx/build/

    4. Once the image has been built, save it as docker tar file with the command docker save mybenchimage:0.0.1 | bzip2 > ../mybenchimage-0.0.1.tar.bz2 The resulting tar file will appear next to the root folder of your docker files.

    1. Open Platform Core and log in.

    2. Go to Projects > your_project > Data.

    3. For small Docker images, upload the docker image file which you generated in the previous step. For large Docker images use the service connector to better performance and reliability to import the Docker image.

    4. Select the uploaded image file and perform Manage > Change Format.

    5. From the format list, select DOCKER and save the change.

    6. Go to System Settings > Docker Repository > Create > Image.

    7. Select the uploaded docker image and fill out the other details.

      • Name: The name by which your docker image will be seen in the list

      • Version: A version number to keep track of which version you have uploaded. In our example this was 0.0.1

    8. Once the settings are entered, select Save. The creation of the Docker image typically takes between 5 and 30 minutes. The status of your docker image will be partial during creation and available once completed.

    1. Navigate to Projects > your_project > Bench > Workspaces.

    2. Create a new workspace with + Create Workspace or edit an existing workspace.

    3. Fill in the bench workspace details according to Workspaces.

    4. Save your changes.

    5. Select Start Workspace

    6. Wait for the workspace to be started and you can access it either via console or the GUI.

    Once your bench image has been started, you can access it via console, web or both, depending on your configuration.

    • Web access (HTTP) is done from either Projects > your_project > Bench > Workspaces > your_Workspace > Access tab or from the link provided at provided in your running workspace at Projects > your_project > Bench > Workspaces > your_Workspace > Details tab > Access section.

    • Console access (SSH) is performed from your command prompt by going to the path provided in your running workspace at Projects > your_project > Bench > Workspaces > your_Workspace > Details tab > Access section.

    To execute the commands, your workspace needs a way to run them such as the inclusion of an SSH daemon, be it integrated into your web access image or into your console access. There is no need to download the workspace command-line interface, you can run it from within the workspace.

    • The bench image will be instantiated as a container which will be forcedly started as user with UID 1000 and GID 100.

    • You cannot elevate your permissions in a running workspace.

    Only the following folders are writeable:

    • /data

    • /tmp

    All other folders are mounted as read-only.

    For inbound access, the following ports on the container are publicly exposed, depending on the selection made at startup.

    • Web: TCP/8888

    • Console: TCP/2222

    For outbound access, a workspace can be started in two modes:

    • Public: Access to public IP’s is allowed using TCP protocol.

    • Restricted: Access to list of URLs are allowed.

    At runtime, the following Bench-specific environment variables are made available to the workspace instantiated from the Bench image.

    Name
    Description
    Example Values

    ICA_WORKSPACE

    The unique identifier related to the started workspace. This value is bound to a workspace and will never change.

    32781195

    ICA_CONSOLE_ENABLED

    Whether Console access is enabled for this running workspace.

    true, false

    Following files and folders will be provided to the workspace and made accessible for reading at runtime.

    Name
    Description

    /etc/workspace-auth

    Contains the SSH rsa public/private keypair which is required to be used to run the workspace SSHD.

    At runtime, Platform Core-related software will automatically be made available at /data/.software in read-only mode.

    New versions of Platform Core software will be made available after a restart of your workspace.

    Name
    Description

    /data

    This folder contains all data specific to your workspace.

    Data in this folder is not persisted in your project and will be removed at deletion of the workspace.

    /data/project

    This folder contains all your project data.

    /data/.software

    This folder contains Platform Core-related software.

    When a bench workspace is instantiated from your selected bench image, the following script is invoked: /usr/local/bin/ica_start.sh

    This script is the main process in your running workspace and cannot run to completion as it will stop the workspace and instantiate a restart (see init script).

    This script can be used to invoke other scripts.

    When you stop a workspace, a TERM signal is sent to the main process in your bench workspace. You can trap this signal to handle the stop gracefully (see shutdown script) and shut down child processes of the main process. The workspace will be forcedly shut down after 30 seconds if your main process hasn’t stopped within the given period.

    If you get the error "docker buildx build" requires exactly 1 argument when trying to build your docker image, then a possible cause is missing the last . of the command.

    When you stop the workspace when users are still actively using it, they will receive a message showing a Server Connection Error.

    Requirements

    For easy reference, you can find examples of preconfigured Bench images on the Illumina website which you can copy to your local machine and edit to suit your needs.

    Bench-console provides an example to build a minimal image compatible with Platform Core Bench to run a SSH Daemon.

    Bench-web provides an example to build a minimal image compatible with Platform Core Bench to run a Web Daemon.

    Bench-rstudio provides an example to build a minimal image compatible with Platform Core Bench to run a rStudio Open Source.

    These examples come with information on the available parameters.

    Scripts

    Init Script (Dockerfile)

    https://docs.docker.com/reference/dockerfile/
    Illumina website
    # Init script invoked at start of a bench workspace
    COPY --chmod=0755 --chown=root:root ${FILES_BASE}/ica_start.sh /usr/local/bin/ica_start.sh
    # Bench workspaces need to run as user with uid 1000 and be part of group with gid 100
    RUN adduser -H -D -s /bin/bash -h ${HOME} -u 1000 -G users ica
    # Terminate function
    function terminate() {
            # Send SIGTERM to child processes
            kill -SIGTERM $(jobs -p)
    
            # Send SIGTERM to waitpid
            echo "Stopping ..."
            kill -SIGTERM ${WAITPID}
    }
    
    # Catch SIGTERM signal and execute terminate function.
    # A workspace will be informed 30s before forcefully being shutdown.
    trap terminate SIGTERM
    
    # Hold init process until TERM signal is received
    tail -f /dev/null &
    WAITPID=$!
    wait $WAITPID

    User (Dockerfile)

    Shutdown Script (ica_start.sh)

    Building a Bench Image

    If you want to build on a mac with Apple Silicon, then the build command is docker buildx build --platform linux/amd64 -f Dockerfile -t mybenchimage:0.0.1 .

    Upload Your Docker Image to Platform Core

    Start Your Bench Image

    Access Bench Image

    The password needed for SSH access is any one of your personal

    Command-line Interface

    Restrictions

    Root User

    Do not run containers as root as this is bad security practice.

    Read-only Root Filesystem

    Network Access

    Context

    Environment Variables

    Configuration Files

    Software Files

    Important Folders

    Bench Lifecycle

    Workspace Lifecycle

    This script needs to be available and executable otherwise your workspace will not boot.

    Troubleshooting

    Build Argument

    Server Connection Error

    • If headers are used: The columns that have matching fields are loaded, those that have no matching fields are loaded with NULL and remaining fields are discarded.

    • If no headers are used: The fields are loaded in order of occurrence and trailing missing fields are loaded with NULL, trailing additional fields are discarded.

    reference to the pipeline execution. This field consists of the user reference in combination with the ID (uuid) of the analysis. You can see these two values on the Projects > your_project > Analysis > your_analysis > Details tab.

    analysis_id

    The ID (uuid) of the analysis. You can see this uuid on the Projects > your_project > Analysis > your_analysis > Details tab.

    pipeline_name

    Name of the pipeline. You can see this name at Projects > your_project > Flow > Pipelines > your_pipeline > Code.

    pipeline_reference

    (internal) Reference to the pipeline.

    pipeline_id

    The uuid of the pipeline, you can see this uuid at Projects > your_project > Flow > Pipelines > your_pipeline > Details > ID.

    sample_name

    Name of the sample.

    sample_reference

    (internal) Reference to the sample.

    sample_id

    The uuid of the sample. You can see this uuid in the URL of the sample after the /samples/ tag.

    tenant_name

    Name of the tenant.

    tenant_reference

    Reference to the tenant.

    Header rows to skip

    The number of consecutive header rows (at the top of the table) to skip.

    References

    Choose which references must be added to the table.

    3

    3

    3

    Canada (CA)

    4E70F8E1A204A4B2A22E4F7BA9A06D27

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ca-central-1.amazonaws.com/id/4E70F8E1A204A4B2A22E4F7BA9A06D27

    ca-central-1

    cac1

    Germany (EU)

    FD40D1945EBD71D8433A98C0CE04E625

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.eu-central-1.amazonaws.com/id/FD40D1945EBD71D8433A98C0CE04E625

    eu-central-1

    euc1

    India (IN)

    4C3E0D308DB6DA9625FF938C57DAB3B6

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-south-1.amazonaws.com/id/4C3E0D308DB6DA9625FF938C57DAB3B6

    ap-south-1

    aps3

    Indonesia (ID)

    0E0C765DA73BD1FC509FAC71F92BDB5C

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-southeast-3.amazonaws.com/id/0E0C765DA73BD1FC509FAC71F92BDB5C

    ap-southeast-3

    aps4

    Israel (IL)

    EB5CD54864FC17FE53C44E8F9E3943DC

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.il-central-1.amazonaws.com/id/EB5CD54864FC17FE53C44E8F9E3943DC

    il-central-1

    ilc1

    Japan (JP)

    31343141B6F8EA41F379AE795CFA7638

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-northeast-1.amazonaws.com/id/31343141B6F8EA41F379AE795CFA7638

    ap-northeast-1

    apn1

    Singapore (SG)

    4839F25C2D7F1765F0523616EB33711F

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-southeast-1.amazonaws.com/id/4839F25C2D7F1765F0523616EB33711F

    ap-southeast-1

    aps1

    South Korea (KR)

    F2F941225297CB2CD58E91A45ED1362D

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-northeast-2.amazonaws.com/id/F2F941225297CB2CD58E91A45ED1362D

    ap-northeast-2

    apn2

    Taiwan (TW)

    D321ECE5E6F7AEA2F7B0BDE546B9EB39

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-east-2.amazonaws.com/id/D321ECE5E6F7AEA2F7B0BDE546B9EB39

    ap-east-2

    ape2

    United Arab Emirates (UAE)

    183FDEC68B2A1075CBF28D81199C1F3B

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.me-central-1.amazonaws.com/id/183FDEC68B2A1075CBF28D81199C1F3B

    me-central-1

    mec1

    UK (GB)

    CC52F03C88D774F70AB9D2E2BABDF225

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.eu-west-2.amazonaws.com/id/CC52F03C88D774F70AB9D2E2BABDF225

    eu-west-2

    euw2

    United States (US -Oregon)

    8AC895F8C45EF3AE1C7053C56A09C5B9

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.us-west-2.amazonaws.com/id/8AC895F8C45EF3AE1C7053C56A09C5B9

    us-west-2

    usw2

    United States (US - N. Virginia)

    10FBA7EDEB5930CCFC300EF5AC3DB2FE

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.us-east-1.amazonaws.com/id/10FBA7EDEB5930CCFC300EF5AC3DB2FE

    us-east-1

    use1

    India (IN)

    https://oidc.eks.ap-south-1.amazonaws.com/id/4C3E0D308DB6DA9625FF938C57DAB3B6

    Indonesia (ID)

    https://oidc.eks.ap-southeast-3.amazonaws.com/id/0E0C765DA73BD1FC509FAC71F92BDB5C

    Israel (IL)

    https://oidc.eks.il-central-1.amazonaws.com/id/EB5CD54864FC17FE53C44E8F9E3943DC

    Japan (JP)

    https://oidc.eks.ap-northeast-1.amazonaws.com/id/31343141B6F8EA41F379AE795CFA7638

    Singapore (SG)

    https://oidc.eks.ap-southeast-1.amazonaws.com/id/4839F25C2D7F1765F0523616EB33711F

    South Korea (KR)

    https://oidc.eks.ap-northeast-2.amazonaws.com/id/F2F941225297CB2CD58E91A45ED1362D

    Taiwan (TW)

    https://oidc.eks.ap-east-2.amazonaws.com/id/D321ECE5E6F7AEA2F7B0BDE546B9EB39

    United Arab Emirates (UAE)

    https://oidc.eks.me-central-1.amazonaws.com/id/183FDEC68B2A1075CBF28D81199C1F3B

    UK (GB)

    https://oidc.eks.eu-west-2.amazonaws.com/id/CC52F03C88D774F70AB9D2E2BABDF225

    United States (US - Oregon)

    https://oidc.eks.us-west-2.amazonaws.com/id/8AC895F8C45EF3AE1C7053C56A09C5B9

    United States (US - N. Virginia)

    https://oidc.eks.us-east-1.amazonaws.com/id/10FBA7EDEB5930CCFC300EF5AC3DB2FE

    Israel (IL)

    arn:aws:iam::079623148045:role/ica_ilc1_crossacct

    Japan (JP)

    arn:aws:iam::079623148045:role/ica_apn1_crossacct

    Singapore (SG)

    arn:aws:iam::079623148045:role/ica_aps1_crossacct

    South Korea (KR)

    arn:aws:iam::079623148045:role/ica_apn2_crossacct

    Taiwan (TW)

    arn:aws:iam::079623148045:role/ica_ape2_crossacct

    United Arab Emirates (AE)

    arn:aws:iam::079623148045:role/ica_mec1_crossacct

    UK (GB)

    arn:aws:iam::079623148045:role/ica_euw2_crossacct

    United States (US - Oregon)

    arn:aws:iam::079623148045:role/ica_usw2_crossacct

    United States (US - N. Virginia)

    arn:aws:iam::079623148045:role/ica_use1_crossacct

    Object Ownership controls who owns objects written to the bucket.

    <YOUR_BUCKET_NAME>: Replace this field with the name of the S3 bucket you created for Platform Core.
    2012-10-17
    "
    ,
    "Statement": [
    {
    "Effect": "Allow",
    "Action": [
    "s3:PutBucketNotification",
    "s3:ListBucket",
    "s3:GetBucketNotification",
    "s3:GetBucketLocation"
    ],
    "Resource": [
    "arn:aws:s3:::<YOUR_BUCKET_NAME>"
    ]
    },
    {
    "Effect": "Allow",
    "Action": [
    "s3:PutObject",
    "s3:GetObject",
    "s3:RestoreObject",
    "s3:DeleteObject",
    "s3:GetObjectTagging",
    "s3:PutObjectTagging"
    ],
    "Resource": "arn:aws:s3:::<YOUR_BUCKET_NAME>/<YOUR_FOLDER_NAME>/*"
    },
    {
    "Effect": "Allow",
    "Action": [
    "sts:GetFederationToken"
    ],
    "Resource": [
    "*"
    ]
    }
    ]
    }
    2012-10-17
    "
    ,
    "Statement": [
    {
    "Sid": "AllowCrossAccountAccess",
    "Effect": "Allow",
    "Principal": {
    "AWS": "<ASSUME_ROLE_ARN>"
    },
    "Action": [
    "s3:PutObject",
    "s3:DeleteObject",
    "s3:ListMultipartUploadParts",
    "s3:AbortMultipartUpload",
    "s3:GetObject",
    "s3:GetObjectTagging",
    "s3:PutObjectTagging"
    ],
    "Resource": [
    "arn:aws:s3:::<YOUR_BUCKET_NAME>",
    "arn:aws:s3:::<YOUR_BUCKET_NAME>/*"
    ]
    }
    ]
    }

    Australia (AU)

    F4CD1AEAE6E0820F305F0230FAF6319C

    arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.ap-southeast-2.amazonaws.com/id/F4CD1AEAE6E0820F305F0230FAF6319C

    ap-southeast-2

    Australia (AU)

    https://oidc.eks.ap-southeast-2.amazonaws.com/id/F4CD1AEAE6E0820F305F0230FAF6319C

    Canada (CA)

    https://oidc.eks.ca-central-1.amazonaws.com/id/4E70F8E1A204A4B2A22E4F7BA9A06D27

    Germany (EU)

    https://oidc.eks.eu-central-1.amazonaws.com/id/FD40D1945EBD71D8433A98C0CE04E625

    Australia (AU)

    arn:aws:iam::079623148045:role/ica_aps2_crossacct

    Canada (CA)

    arn:aws:iam::079623148045:role/ica_cac1_crossacct

    Germany (EU)

    arn:aws:iam::079623148045:role/ica_euc1_crossacct

    India (IN)

    arn:aws:iam::079623148045:role/ica_aps3_crossacct

    Indonesia (ID)

    You can only download or copy this value now during creation. Once this dialog box closes after saving, you can no longer access this value.

    Storage Configuration

    If the role time is not set to 12 hours, the storage configuration will not go online.

    Trust Policy

    Note the double colon symbol (::) before your AWS client account number

    Example

    OIDC Reference table

    Replace <your AWS client account number> with your actual AWS client account number

    OIDC Provider Locations

    Be sure to replace the following fields:

    • YOUR_BUCKET_NAME: Replace this field with the name of the S3 bucket you created for Platform Core.

    • YOUR_ACCOUNT_ID: Replace this field with your account ID number.

    • YOUR_IAM_ROLE: Replace this field with the name of your IAM role created for Platform Core.

    Create a Storage Configuration
    AWS client account number
    OIDC reference table
    OIDC reference table
    OIDC reference table
    Create Platform Core storage credential
    Create AWS IAM Policy
    Storage Configuration
    table
    Trust Policy
    IAM policy
    organisational policies
    {
         "Version": "2012-10-17",
         "Statement": [
             {
                 "Effect": "Deny",
                 "Principal": {
                     "AWS": "*"
                 },
                 "Action": [
                     "s3:PutObject",
                     "s3:GetObject",
                     "s3:RestoreObject",
                     "s3:DeleteObject",
                     "s3:DeleteObjectVersion",
                     "s3:GetObjectVersion",
                     "s3:GetObjectTagging",
                     "s3:PutObjectTagging",
                     "s3:GetObjectVersionTagging",
                     "s3:PutObjectVersionTagging"
                 ],
                 "Resource": "arn:aws:s3:::YOUR_BUCKET_NAME/*",
                 "Condition": {
                     "ArnNotLike": {
                         "aws:PrincipalArn": [
                             "arn:aws:iam::YOUR_ACCOUNT_ID:role/YOUR_IAM_ROLE",
                             "arn:aws:sts::YOUR_ACCOUNT_ID:federated-user/*"
                         ]
                     }
                 }
             }
         ]
     }

    aps2

    arn:aws:iam::079623148045:role/ica_aps4_crossacct

    {
        "Version": "2012-10-17",
        "Statement": [
            {
                "Effect": "Allow",
                "Principal": {
                    "Federated": "arn:aws:iam::<your AWS client account number>:oidc-provider/oidc.eks.<region-alias>.amazonaws.com/id/<OIDC Provider ID>"
                },
                "Action": "sts:AssumeRoleWithWebIdentity",
                "Condition": {
                    "StringLike": {
                        "oidc.eks.<region-alias>.amazonaws.com/id/<OIDC Provider ID>:sub": "system:serviceaccount:<namespace>:irsa-<namespace>-gds*",
                        "oidc.eks.<region-alias>.amazonaws.com/id/<OIDC Provider ID>:aud": "sts.amazonaws.com",
                        "sts:RoleSessionName": "<session name prefix>-*"
                    }
                }
            }
        ]
        }
        {
        "Version": "2012-10-17",
        "Statement": [
            {
                "Effect": "Allow",
                "Principal": {
                    "Federated": "arn:aws:iam::123456789:oidc-provider/oidc.eks.us-east-1.amazonaws.com/id/10FBA7EDEB5930CCFC300EF5AC3DB2FE"
                },
                "Action": "sts:AssumeRoleWithWebIdentity",
                "Condition": {
                    "StringLike": {
                        "oidc.eks.us-east-1.amazonaws.com/id/10FBA7EDEB5930CCFC300EF5AC3DB2FE:sub": "system:serviceaccount:use1:irsa-use1-gds*",
                        "oidc.eks.us-east-1.amazonaws.com/id/10FBA7EDEB5930CCFC300EF5AC3DB2FE:aud": "sts.amazonaws.com",
                        "sts:RoleSessionName": "mUlP0AqBmwf9CMpjEUFY7J2z60sdveP-*"
                    }
                }
            }
        ]
        }
    Description: Provide a description explaining what your docker images does or is suited for.
  • Type: The type of this image is Bench. The Tool type is reserved for tool images.

  • Cluster compatible: Indicates if this docker images is suited for cluster computing.

  • Access: This setting must match the available access options of your Docker image. You can choose web access (HTTP), console access (SSH) or both. What is selected here becomes available on the + New Workspace screen. Enabling an option here which your Docker image does not support, will result in access denied errors when trying to run the workspace.

  • Regions: If your tenant has access to multiple regions, you can select to which regions to replicate the docker image.

  • ICA_WEB_ENABLED

    Whether Web access is enabled for this running workspace.

    true, false

    USER_TOKEN_PATH

    The location of the token file which contains the credentials needed for interaction with ICA. See workspaces for usage.

    ICA_BENCH_URL

    The host part of the public URL which provides access to the running workspace.

    use1-bench.platform.illumina.com

    ICA_PROJECT_UUID

    The unique identifier related to the ICA project in which the workspace was started.

    ICA_URL

    The ICA Endpoint URL.

    https://ica.illumina.com/ica

    HTTP_PROXY

    HTTPS_PROXY

    The proxy endpoint in case the workspace was started in restricted mode.

    HOME

    The home folder.

    /data

    API keys

    Analyses

    An Analysis is the execution of a pipeline.

    Starting Analyses

    You can start an analysis from both the dedicated analysis screen or from the actual pipeline.

    From Analyses

    1. Navigate to Projects > Your_Project > Flow > Analyses.

    2. Select Start.

    3. Select a single Pipeline.

    4. Configure the.

    5. Select Start Analysis.

    6. Refresh to see the analysis status. See for more information on statuses.

    7. If for some reason, you want to end the analysis before it can complete, select Projects > Your_Project > Flow > Analyses > Manage > Abort. Refresh to see the status update.

    1. Navigate to Projects > <Your_Project> > Flow > Pipelines

    2. Select the pipeline you want to run or open the pipeline details of the pipeline which you want to run.

    3. Select Start Analysis.

    You can abort a running analysis from either the analysis overview (Projects > your_project > Flow > Analyses > your_analysis > Manage > Abort) or from the analysis details (Projects > your_project > Flow > Analyses > your_analysis > Details tab > Abort).

    Once an analysis has been executed, you can rerun it with the same settings or choose to modify the parameters when rerunning. Modifying the parameters is possible on a per-analysis basis. When selecting multiple analyses at once, they will be executed with the original parameters. Draft pipelines are subject to updates and thus can result in a different outcome when rerunning. Platform Core will display a warning message to inform you of this when you try to rerun an analysis based on a draft pipeline.

    When there is an XML configuration change on a a pipeline for which you want to rerun an analysis, Platform Core will display a warning and not fill out the parameters as it cannot guarantee their validity for the new XML. You will need to provide the input data and settings again to rerun the analysis.

    Some restrictions apply when trying to rerun an analysis.

    Analyses
    Rerun
    Rerun with modified parameters

    To rerun one or more analyses with te same settings:

    1. Navigate to Projects > Your_Project > Flow > Analyses.

    2. In the overview screen, select one or more analyses.

    3. Select Manage > Rerun. The analyses will now be executed with the same parameters as their original run.

    To rerun a single analysis with modified parameters:

    1. Navigate to Projects > Your_Project > Flow > Analyses.

    2. In the overview screen, open the details of the analysis you want to rerun by clicking on the analysis user reference.

    3. Select Rerun. (at the top right)

    Status
    Description
    Final State

    During the execution of an analysis, logs are produced for each process involved in the analysis lifecyle. In the analysis details view, the Steps tab is used to view the steps in near real time as they're produced in the running processes. A grid layout is used for analyses with more than 50 steps, a tiled view for analyses with 50 steps or less, though you can choose to also use the grid layout for those by means of the tile/grid button on the top right of the analysis log tab. The steps tab also shows which resources were used as compute type in the different main analysis steps. (For child steps, these are displayed on the parent step)

    There are system processes involved in the lifeycle for all analyses (ie. downloading inputs, uploading outputs, etc.) and there are processes which are pipeline-specific, such as processes which execute the pipeline steps. The below table describes the system processes. You can choose to display or hide these system processes with the Show technical steps

    Process
    Description

    Additional log entries will show for the processes which execute the steps defined in the pipeline.

    Each process shows as a distinct entry in the steps view with a Queue Date, Start Date, and End Date.

    Timestamp
    Description

    The time between the Start Date and the End Date is used to calculate the duration. The time of the duration is used to calculate the usage-based cost for the analysis. Because this is an active calculation, sorting on this field is not supported.

    Each log entry in the Steps view contains a checkbox to view the stdout and stderr log files for the process. Clicking a checkbox adds the log as a tab to the log viewer where the log text is displayed and made available for download.

    To see the price of an analysis in BioInsight Credits (BIC), look at Projects > your_project > Flow > Analyses > your_analysis > Details tab. The pricing section will show you the entitlement bundle, storage detail and price in BIC once the analysis has succeeded, failed or been aborted.

    By default, the stdout and stderr files are located in the ica_logs subfolder within the analysis. This location can be changed by selecting a different in the current project at the start of the analysis. Do not use a folder which already contains log files as these will be overwritten. To set the log file location, you can also use the CreateAnalysisLogs section of the Create Analysis .

    You can access the log files from the analysis details (projects > your_project > flow > analysis > your_analysis > details tab)

    Logs can also be streamed using websocket client tooling. The API to retrieve analysis step details returns websocket URLs for each step to stream the logs from stdout/stderr during the step's execution. Upon completion, the websocket URL is no longer available.

    By default, analysis outputs are directed to a new folder within the project where the analysis is launched. Analysis output mappings may be specified to redirect outputs to user-specified locations consisting of project and path. An output mapping consists of:

    • the source path on the local disk of the analysis execution environment, relative to the working folder.

    • the data type, either FILE or FOLDER

    • the target project ID to direct outputs to; analysis launcher must have contributor access to the project.

    You can jump from the Analysis Details to the individual files and folders by opening the output files tab on the detail view (Projects > your_project > Flow > Analyses > your_analysis > Output files tab > your_output_file) and selecting Open in data.

    analysis output
    logs output
    Notes

    You can add and remove tags from your analyses.

    1. Navigate to Projects > Your_Project > Flow > Analyses.

    2. Select the analyses whose tags you want to change.

    3. Select Manage > Manage tags.

    Both system tags and customs tags exist. User tags are custom tags which you set to help identify and process information while technical tags are set by the system for processing. Both run-in and run-out tags are set on data to identify which analyses use the data. Connector tags determine data entry methods and reference data tags identify where data is used as reference data.

    If you want to share a link to an analysis, you can copy and paste the URL from your browser when you have the analysis open. The syntax of the analysis link will be <hostURL>/ica/link/project/<projectUUID>/analysis/<analysisUUID>. Likewise, workflow sessions will use the syntax <hostURL>/ica/link/project/<projectUUID>/workflowSession/<workflowsessionUUID>. To prevent third parties from accessing data via the link when it is shared or forwarded, Platform Core will verify the access rights of every user when they open the link.

    Input for analysis is limited to a total of 50,000 files (including multiple copies of the same file). Concurrency limits on analyses prevent resource hogging which could result in resource starvation for other tenants. Additional analyses will be queued and scheduled when currently running analyses complete and free up positions. The theoretical limit is 20, but this can be less in practice, depending on a number of external factors.

    When your analysis fails, open the analysis details view (Projects > your_project> Flow > Analyses > your_analysis) and select display failed steps. This will give you the steps view filtered on those steps that had non-0 exit codes. If there is only one failed step which has logfiles, the stderr of that step will be displayed.

    • Exit code 55 indicates analysis failure on economy instances due to an external event such as spot termination. You can retry the analysis.

    • Exit code 56 indicates analysis failure due to pod disruption and deletion by Kubernetes' Pod Garbage Collector (PodGC) because the node it was running on no longer exists. You can retry the anlaysis.

    Nextflow

    Platform Core supports running pipelines defined using Nextflow. See this tutorial for an example.

    In order to run Nextflow pipelines, the following process-level attributes within the Nextflow definition must be considered.

    System Information

    Pipelines using Nextflow v20.10 will no longer run after April 22nd, 2026 and instead display "This pipeline is on an outdated nextflow version no longer supported on Platform Core". See the planned obsolescence notice below.

    163KB
    pon2025-1808-nextflow-v20-10.PDF
    PDF
    Open

    Nextflow version

    22.04 (deprecated ⚠️), 24.10 (supported ✅), 25.10 (default ⭐)

    Executor

    Kubernetes

    The following table shows when which Nextflow version is

    • Default (⭐) This version will be proposed when creating a new Nextflow pipeline.

    • Supported (✅) This version can be selected when you do not want the default Nextflow version.

    • Deprecated (⚠️) This version can not be selected for new pipelines, but pipelines using this version will still work.

    The switchover happens in the January release of that year.

    Nextflow Version
    2026
    2027
    2028

    You can select the Nextflow version while building a pipeline as follows:

    To specify a compute type for a Nextflow process, you can either define the cpu and memory (recommended) or use the compute type sizes (required for specific hardware such as FPGA2).

    Specify the task resources using Nextflow directives in both the workflow script (.nf) and the configuration file (nextflow.config) cpus defines the number of CPU cores allocated to the process, memory defines the amount of RAM which will be allocated.

    Process file example

    Configuration file example

    Platform Core will convert the required resources to the correct predefined size. This enables porting public Nextflow pipelines without configuration changes.

    To use the predefined sizes, use the within each process. Set the annotation to scheduler.illumina.com/presetSize and the value to the desired compute type. The default compute type, when this directive is not specified, is standard-small (2 CPUs and 8 GB of memory).

    For example, if you want to use , you need to add the line below

    For each compute type, you can choose between the

    • scheduler.illumina.com/lifecycle: standard - (Default) or

    • scheduler.illumina.com/lifecycle: economy - tiers.

    On-Demand Instance
    Spot Instance

    You can switch to economy in the process itself with the pod directive or in the nextflow.config file.

    Process example

    nextlow.config example

    Inputs are specified via the form or . The specified code in the XML will correspond to the field in the params object that is available in the workflow. Refer to the for an example.

    Outputs for Nextflow pipelines are uploaded from the out folder in the attached shared filesystem.

    The can be used to symlink (recommended for publishing files and folders to single destinations), link (recommended for publishing the same file to multiple locations) copy or move data to the correct folder.

    • Symlinking is fast and does not increase storage cost as it creates a file pointer instead of copying or moving data. It can handle both individual files and folders, but it can not publish the same data to multiple destinations and is not resistant to deletion of the original file.

    • Linking creates a hard link to the file and so does not increase storage cost either. It also keeps working after deletion (removing the reference) of the original file. Linking supports publishing the same file to multiple destinations. It can be used for files, but not folders and the files must be on the same filesystem.

    Data will be uploaded to the Platform Core project after the pipeline execution completes.

    During execution, the Nextflow pipeline runner determines the environment settings based on values passed via the command-line or via a configuration file (see ). When creating a Nextflow pipeline, use the nextflow.config tab in the UI (or API) to specify a nextflow configuration file to be used when launching the pipeline.

    Syntax highlighting is determined by the file type, but you can select alternative syntax highlighting with the drop-down selection list.

    The following configuration settings will be ignored if provided as they are overridden by the system:

    Setting a timeout to between 2 and 4 times the expected processing time with the directive for processes or task will ensure that no stuck processes remain indefinitely. Stuck process keep incurring costs for the occupied resources, so if the process can not complete within that timespan, it is safer and more economical to end the process and retry.

    When you want to use a sample sheet with references to files as Nextflow input, add an extra input to the pipeline. This extra input lets the user select the samplesheet-mentioned files from their project. At run time, those files will get staged in the working directory, and when Nextflow parses the samplesheet and looks for those files without paths, it will find them there. You can not use file paths in a sample sheet without selecting the files in the input form because files are only passed as file/folder ids in the API payload when the analysis is launched.

    You can include public data such as http urls because Nextflow is able download those. Nextflow is also able to download publicly accessible S3 urls (s3://...). You can not use Illumina's urn:ilmn:ica:region:... structure.

    New versions of existing DRAGEN workflows have been created to support F2 (FPGA2) instances as F1 (FPGA) instances have been decommissioned. Please consult the for more information. You will need to migrate your pipelines from FPGA to FPGA2.

    As long as your pipeline is still in status, you can update them with the FPGA2 configuration, but once the pipeline has been , you need to clone and edit the pipeline as it is protected against editing. Cloning the pipeline is done at projects > your_project > Flow > Pipelines > open pipeline details > Clone (top right). Setting the compute resources can be done in the .nf file directly or in the nextflow.config file.

    Starting with Nextflow version 22.08, Nextflow no longer overrides the container ENTRYPOINT with /bin/bash. Previously, Nextflow would force bin/bash as the entrypoint regardless of what the image defined, which meant environment setup in custom ENTRYPOINTs (such as conda activation scripts) was silently being bypassed. As of Nextflow 22.08, the container's native ENTRYPOINT is respected.

    Containers relying on a custom ENTRYPOINT to set up the environment (e.g., activating a conda environment or prepending to PATH) will no longer have /bin/bash injected as the shell. If tools are not directly callable from the default shell PATH, you will encounter "command not found" errors.

    To verify that a container image is compatible, run the following command locally for each tool used in your pipeline:

    This command must complete successfully (exit code 0 and display the tool help text). If it fails with "command not found", the image needs to be updated so that the tool is directly callable without relying on ENTRYPOINT for environment setup.

    This solution can be used for quick fixes, but has a higher maintenance cost as it uses hardcoded paths.

    This mimics the legacy behavior of what ENTRYPOINT used to do.

    The old behavior can be temporarily restored by setting the environment variable

    This option is and can be removed without notice in any future Nextflow release, at which point any pipeline depending on it will no longer function.

    Workspaces

    The main concept in Bench is the Workspace. A workspace is an instance of a Docker image that runs the framework which is defined in the image (for example JupyterLab, R Studio). In this workspace, you can write and run code and graphically represent data. You can use API calls to access data, analyses, Base tables and queries in the platform. Via the command line, R-packages, tools, libraries, IGV browsers, widgets, etc. can be installed.

    You can create multiple workspaces within a project and each workspace runs on an individual node and is available in different resource sizes. Each node has local storage capacity, where files and results can be temporarily stored and exported from to be permanently stored in a Project. The size of the storage capacity can range from 1GB – 16TB.

    Once a workspace is started, it will be restarted every 30 days for security reasons. Even when you have automatic shutdown configured to be more than 30, the workspace will be restarted after 30 days and the remaining days will be counted in the next cycle.

    You can see the remaining time until the next event (Shutdown or restart) in the workspaces overview and on the workspace details.

    Create Workspace

    If this is the first time you are using a workspace in a Project, click Enable to create new Bench Workspaces. In order to use Bench, you first need to have a workspace. This workspace determines which docker image will be used with which node and storage size.

    1. Click Projects > Your_Project > Bench > Workspaces > + Create Workspace

    2. Complete the following fields and save the changes.

    Field
    Explanation

    The workspace can be edited on the workspace Details tab once it is stopped. The changes will be applied when the workspace is restarted.

    When Access limited to workspace owner is selected, only the workspace owner can access the workspace. Everything created in that workspace will belong to the workspace owner.

    • Bench administrators are able to create, edit and delete workspaces and start and stop workspaces. If their permissions match or exceed those of the workspace, they can also access the workspace contents.

    • Contributors are able to start and stop workspaces and if their permissions match or exceed those of the workspace, they can also access the workspace contents.

    create/edit
    delete
    start/stop
    access contents

    The setting determines if someone is an administrator or contributor, while the dedicated indicate what the workspace itself can and cannot do within your project. For this reason, the users need to meet or exceed the required permissions to enter this workspace and use it.

    The permissions that a Bench workspace can receive are the following:

    • Upload rights

    • Download rights (required)

    • Project (No Access - Dataprovider - Viewer - Contributor)

    • Flow (No Access - Viewer - Contributor)

    Based on these permissions, you will be able to upload or download data to your Platform Core project (upload and download rights) and will be allowed to take actions in the Project, Flow and Base modules related to the granted permission.

    If you encounter issues when uploading/downloading data in a workspace, the security settings for that workspace may be set to not allow uploads and downloads. This can result in RequestError: send request failed and read: connection reset by peer. This is by design in restricted workspaces and thus limits data access to your project via /data/project to prevent the extraction of large amounts of (proprietary) data.

    To delete a workspace with the GUI, go to Projects > your_project > Bench > Workspaces > your_workspace and click “Delete”. Note that the delete option is only available when the workspace is stopped.

    The workspace will not be accessible anymore, nor will it be shown in the list of workspaces. The content of it will be deleted so if there is any information that should be kept, you can either put it in a docker image which you can use to start from next time, or export it using the API.

    The workspace is not always accessible. It needs to be started before it can be used. From the moment a workspace is Running, a node with a specific capacity is assigned to this workspace. From that moment on, you can start working in your workspace.

    To start the workspace, follow the next steps:

    1. Go to Projects > your_project > Bench > Workspaces > your_workspace > Details

    2. Click on Start Workspace button

    3. On the top of the details tab, the status changes to “Starting”. When you click on the >_Access tab, the message “The workspace is starting” appears.

    You can refresh the workspace status by selecting the round refresh symbol at the top right.

    Once a workspace is running, it can be manually stopped or it will be automatically shut down after the amount of time configured in the field. Even with automatic shutdown, it is still best practice to stop your workspace run when you no longer need it to save costs.

    GUI

    When you exit a workspace, you can choose to stop the workspace or keep it running. Keeping the workspace running means that it will continue to use resources and incur associated costs. To stop the workspace, select stop in the displayed dialog. You can also stop a workspace by opening it and selecting stop at the top right.

    General

    Stopping the workspace will stop the notebook, but will not delete local data. Content will no longer be accessible and no actions can be performed until it is restarted. Any work that has been saved will stay stored.

    The project/tenant administrator can enter and stop workspaces for their project/tenant even if they did not start those workspaces at Projects > your_project > Bench > Workspaces > your_workspace > Details. Be careful not to stop workspaces that are processing data. For security reasons, a log entry is added when a project/tenant administrator enters and exits a workspace.

    You can see who is using a workspace in the workspace list view.

    Once the Workspace is running, the default applications are loaded. These are defined by the start script of the docker image.

    The docker images provided by Illumina will load JupyterLab by default. It also contains Tutorial notebooks that can help you get started. Opening a new terminal can be done via the Launcher, + button above the folder structure.

    To ensure that packages (and other objects, including data) are permanently installed on a Bench image, a new Bench image needs to be created, using the BUILD option in Bench. A new image can only be derived from an existing one. The build process uses the DOCKERFILE method, where an existing image is the starting point for the new Docker Image (The FROM directive), and any new or updated packages are additive (they are added as new layers to the existing Docker file).

    In order to create a derived image, open up the image that you would like to use as the basis and select the Build tab.

    • Name: By default, this is the same name as the original image and it is recommended to change the name.

    • Version: Required field which can by any value.

    • Description: The description for your docker image (for example, indicating which apps it contains).

    The first 4 lines of the Docker file must NOT be edited. It is not possible to start a docker file with a different FROM directive. The main docker file commands are RUN and COPY. More information on them is available in the official Docker documentation.

    Once all information is present, click the Build button. Note that the build process can take a while. Once building has completed, the docker image will be available on the Data page within the Project. If the build has failed, the log will be displayed here and the log file will be in the Data list.

    From within the workspace it is possible to create a tool from the Docker image.

    1. Click the Manage > Create CWL Tool button in the top right corner of the workspace.

    2. Give the tool a name.

    3. Replace the description of the tool to describe what it does.

    4. Add a version number for the tool.

    The building can take a while. When it has completed, the tool will be available in the Tool Repository.

    To export data from your workspace to your local machine, it is best practice to move the data in your workspace to the /data/project/ folder so that it becomes available in your project under projects > your_project > Data. Although this storage is slow, it offers read and write access and access to the content from within ICA.

    • For fast read-only access, link folders with the workspace-ctl data create-mount --mode read-only.

    • For fast read/write access, link which are visible, but whose contents are not accessible from Platform Core. Use the workspace-ctl data create-mount --mode read-write to do so. You can not have fast read-write access to indexed folders as the indexing mechanism on those would deteriorate the performance.

    Every workspace you start has a read-only /data/.software/ folder which contains the icav2 command-line interface (and readme file).

    The last tab of the workspace is the activity tab. On this tab all actions performed in the workspace are shown. For example, the creation of the workspace, starting or stopping of the workspace,etc. The activities are shown with their date, the user that performed the action and the description of the action. This page can be used to check how long the workspace has run.

    In the general Activity page of the project, there is also a Bench activity tab. This shows all activities performed in all workspaces within the project, even when the workspace has been deleted. The Activity tab in the workspace only shows the action performed in that workspace. The information shown is the same as per workspace, except that here the workspace in which the action is performed is listed as well.

    Oncology Walk-through

    This walk-through is intended to represent a typical workflow when building and studying a cohort of oncology cases.

    Create a Cancer Cohort and View Subject Details

    1. Click Create Cohort button.

    2. Select the following studies to add to your cohort:

      1. TCGA – BRCA – Breast Invasive Carcinoma

      2. TCGA – Ovarian Serous Cystadenocarcinoma

    3. Add a Cohort Name = TCGA Breast and Ovarian_1472

    4. Click on Apply.

    5. Expand Show query details to see the study makeup of your cohort.

    6. Charts will be open by default. If not, click Show charts

    7. Use the gear icon in the top-right to change viewable chart settings.

    1. The Subject tab with all Subjects list is displayed below Charts with a link to each Subject by ID and other high-level information, like Data Types measured and reported. By clicking a subject ID, you will be brought to the data collected at the Subject level.

    2. Search for subject TCGA-E2-A14Y and view the data about this Subject.

    3. Click the TCGA-E2-A14Y Subject ID link to view clinical data for this Subject that was imported via the metadata.tsv file on ingest.

    1. Click X to close the Subject details.

    2. Click Hide charts to increase interactive landscape.

    1. Click the Marker Frequency tab, then click the Somatic Mutation tab.

    2. Review the gene list and mutation frequencies.

    3. You will notice PIK3CA has a high rate of mutation in the Cohort (ranked 2nd with 33% mutation frequency in 326 of the 987 Subjects that have Somatic Mutation data in this cohort).

    JSON Schema

    In the InputForm.json, use the syntax for the individual components you want to as listed below. This is a listing of all the currently available components and not to be used "as is", but adapted to the inputs you need in your inputform. For more information on JSON schema syntax, please see the .

    json-schema website
    Configure analysis settings.
  • Select Start Analysis.

  • View the analysis status on the Analyses page. See lifecycle for more information on statuses.

  • If for some reason, you want to end the analysis before it can complete, select Manage > Abort on the Analyses page.

  • Analyses using user-provided input json

    Allowed

    -

    Analyses using advanced output mappings

    -

    -

    Analyses with draft pipeline

    Warn

    Warn

    Analyses with XML configuration change

    Warn

    Warn

    Update the parameters you want to change.
  • Select Start Analysis The analysis will now be executed with the updated parameters.

  • Initializing

    Initializing environment and performing validations for Analysis

    No

    Preparing Inputs

    Downloading inputs for Analysis

    No

    In Progress

    Analysis execution is in progress

    No

    Generating outputs

    Transferring the Analysis results

    No

    Aborting

    Analysis has been requested to be aborted

    No

    Aborted

    Analysis has been aborted

    Yes

    Failed

    Analysis has finished with error

    Yes

    Succeeded

    Analysis has finished with success

    Yes

    Pipeline Runner

    Parent process to execute the pipeline definition

    Finalize Output Data

    Upload Output Data

    the target path relative to the root of the project data to write the outputs.

    Default

    Mapped

    Outputs and logs may be separated.

    Mapped

    Mapped

    Outputs and logs may be separated.

    Edit the user tags, reference data tags (if applicable) and technical tags.
  • Select Save to confirm the changes.

  • Analyses using external data

    Allowed

    -

    Analyses using mount paths on input data

    Allowed

    Requested

    The request to start the Analysis is being processed

    No

    Queued

    Analysis has been queued

    No

    Setup Environment

    Validate analysis execution environment is prepared

    Run Monitor

    Monitor resource usage for billing and reporting

    Prepare Input Data

    Download and mount input data to the shared file system

    Queue Date

    The time when the process is submitted to the processes scheduler for execution

    Start Date

    The time when the process has started exection

    End Date

    The time when the process has stopped execution

    Default

    Default

    Logs are a subfolder of the analysis output.

    Mapped

    Default

    Logs are a subfolder of the analysis output.

    From Pipelines or Pipeline details

    Aborting Analyses

    Rerunning Analyses

    When rerunning multiple analysis at the same time (multiselect), the user reference can not be chosen and will be the original user reference (up to 231 characters), followed by _rerun_yyyy-MM-dd_HHmmss.

    You might see parameters (files and folders) on the analysis details tab which are not defined on the XML. This indicates they are added in the xml-pipeline analysis creation endpoint.

    Lifecycle

    During analysis start, Platform Core runs a verification on the input files to see if they are available. When it encounters files that have not completed their upload or transfer, it will report "Data found for parameter [parameter_name], but status is Partial instead of Available". Wait for the file to be available and restart the analysis.

    When an analysis is started, the availability of resources may impact the start time of the pipeline or specific steps after execution has started. Analyses are subject to delay when cloud resources are under high load. When the underlying storage provider runs out of storage resources, the Status field of the Analysis details will indicate this. There is no need to abort or rerun the analysis.

    Analysis steps logs

    Analysis Cost

    Log Files

    If you delete these files, no log information will be available on the analysis details > Steps tab.

    Log Streaming

    Analysis Output Mappings

    Currently, only FOLDER type output mappings are supported

    If the output folder already exists, any existing contents with the same filenames as those output from the pipeline will be overwritten by the new analysis

    Example

    In this example, 2 analysis output mappings are specified. The analysis writes data during execution in the working directory at paths out/test and out/test2. The data contained in these folders are directed to project with ID 4d350d0f-88d8-4640-886d-5b8a23de7d81 and at paths /output-testing-01/ and /output-testing-02/ respectively, relative to the root of the project data.

    The following demonstrates the construction of the request body to start an analysis with the output mappings described above:

    When the analysis completes the outputs can be seen in the Platform Core UI, within the folders designated in the payload JSON during pipeline launch (output-testing-01 and output-testing-02).

    The Output files section of the analyses will always show the generated outputs, even when they have since been deleted from storage. This is done so you can always see which files were generated during the analysis. In this case it will no longer be possible to navigate to the actual output files.

    Tags

    Hyperlinking

    Restrictions

    Troubleshooting

    For pipeline developers: add automatic retrying to the individual steps that fail with error 55 / 56 (provided these steps are idempotent) See tips and tricks for retries.

    analysis settings
    lifecycle
    logs folder
    endpoints

    -

    {
      "$id": "#ica-pipeline-input-form",
      "$schema": "http://json-schema.org/draft-07/schema#",
      "title": "ICA Pipeline Input Forms",
      "description": "Describes the syntax for defining input setting forms for ICA pipelines",
      "type": "object",
      "additionalProperties": false,
      "properties": {
        "fields": {
          "description": "The list of setting fields",
          "type": "array",
          "items": {
            "$ref": "#/definitions/ica_pipeline_input_form_field"
          }
        }
      },
      "required": [
        "fields"
      ],
      "definitions": {
        "ica_pipeline_input_form_field": {
          "$id": "#ica_pipeline_input_form_field",
          "type": "object",
          "additionalProperties": false,
          "properties": {
            "id": {
              "description": "The unique identifier for this field. Will be available with this key to the pipeline script.",
              "type": "string",
              "pattern": "^[a-zA-Z-0-9\\-_\\.\\s\\+\\[\\]]+$"
            },
            "type": {
              "type": "string",
              "enum": [
                "textbox",
                "checkbox",
                "radio",
                "select",
                "number",
                "integer",
                "data",
                "section",
                "text",
                "fieldgroup"
              ]
            },
            "label": {
              "type": "string"
            },
            "minValues": {
              "description": "The minimal amount of values that needs to be present. Default is 0 when not provided. Set to >=1 to make the field required.",
              "type": "integer",
              "minimum": 0
            },
            "maxValues": {
              "description": "The maximal amount of values that needs to be present. Default is 1 when not provided.",
              "type": "integer",
              "exclusiveMinimum": 0
            },
            "minMaxValuesMessage": {
              "description": "The error message displayed when minValues or maxValues is not adhered to. When not provided a default message is generated.",
              "type": "string"
            },
            "helpText": {
              "type": "string"
            },
            "placeHolderText": {
              "description": "An optional short hint (a word or short phrase) to aid the user when the field has no value.",
              "type": "string"
            },
            "value": {
             "description": "The value for the field. Can be an array for multi-value fields. For 'number' type values the exponent needs to be between -300 and +300 and max precision is 15. For 'integer' type values the value needs to between -100000000000000000 and 100000000000000000"
             },
            "minLength": {
              "type": "integer",
              "minimum": 0
            },
            "maxLength": {
              "type": "integer",
              "exclusiveMinimum": 0
            },
            "min": {
              "description": "Minimal allowed value for 'integer' and 'number' type. Exponent needs to be between -300 and +300 and max precision is 15.",
              "type": "number"
            },
            "max": {
              "description": "Maximal allowed value for 'integer' and 'number' type. Exponent needs to be between -300 and +300 and max precision is 15.",
              "type": "number"
            },
            "choices": {
              "type": "array",
              "items": {
                "$ref": "#/definitions/ica_pipeline_input_form_field_choice"
              }
            },
            "fields": {
              "description": "The list of setting sub fields for type fieldgroup",
              "type": "array",
              "items": {
                "$ref": "#/definitions/ica_pipeline_input_form_field"
              }
            },
            "dataFilter": {
              "description": "For defining the filtering when type is 'data'.",
              "type": "object",
              "additionalProperties": false,
              "properties": {
                "nameFilter": {
                  "description": "Optional data filename filter pattern that input files need to adhere to when type is 'data'. Eg parts of the expected filename",
                  "type": "string"
                },
                "dataFormat": {
                  "description": "Optional dataformat name array that input files need to adhere to when type is 'data'",
                  "type": "array",
                  "contains": {
                    "type": "string"
                  }
                },
                "dataType": {
                  "description": "Optional data type (file or directory) that input files need to adhere to when type is 'data'",
                  "type": "string",
                  "enum": [
                    "file",
                    "directory"
                  ]
                }
              }
            },
            "regex": {
              "type": "string"
            },
            "regexErrorMessage": {
              "type": "string"
            },
            "hidden": {
              "type": "boolean"
            },
            "disabled": {
              "type": "boolean"
            },
            "emptyValuesAllowed": {
              "type": "boolean",
              "description": "When maxValues is greater than 1 and emptyValuesAllowed is true, the values may contain null entries. Default is false."
            },
            "updateRenderOnChange": {
              "type": "boolean",
              "description": "When true, the onRender javascript function is triggered ech time the user changes the value of this field. Default is false."
            },
            "streamable": {
              "type": "boolean",
              "description": "EXPERIMENTAL PARAMETER! Only possible for fields of type 'data'. When true, the data input files will be offered in streaming mode to the pipeline instead of downloading them."
            },
          "required": [
            "id",
            "type"
          ],
          "allOf": [
            {
              "if": {
                "description": "When type is 'textbox' then 'dataFilter', 'fields', 'choices', 'max' and 'min' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "textbox"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "dataFilter",
                      "fields",
                      "choices",
                      "max",
                      "min"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'checkbox' then 'dataFilter', 'fields', 'choices', 'placeHolderText', 'regex', 'regexErrorMessage', 'maxLength', 'minLength', 'max' and 'min' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "checkbox"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "dataFilter",
                      "fields",
                      "choices",
                      "placeHolderText",
                      "regex",
                      "regexErrorMessage",
                      "maxLength",
                      "minLength",
                      "max",
                      "min"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'radio' then 'dataFilter', 'fields', 'placeHolderText', 'regex', 'regexErrorMessage', 'maxLength', 'minLength', 'max' and 'min' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "radio"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "dataFilter",
                      "fields",
                      "placeHolderText",
                      "regex",
                      "regexErrorMessage",
                      "maxLength",
                      "minLength",
                      "max",
                      "min"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'select' then 'dataFilter', 'fields', 'regex', 'regexErrorMessage', 'maxLength', 'minLength', 'max' and 'min' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "select"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "dataFilter",
                      "fields",
                      "regex",
                      "regexErrorMessage",
                      "maxLength",
                      "minLength",
                      "max",
                      "min"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'number' or 'integer' then 'dataFilter', 'fields', 'choices', 'regex', 'regexErrorMessage', 'maxLength' and 'minLength' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "number",
                      "integer"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "dataFilter",
                      "fields",
                      "choices",
                      "regex",
                      "regexErrorMessage",
                      "maxLength",
                      "minLength"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'data' then 'dataFilter' is required and 'fields', 'choices', 'placeHolderText', 'regex', 'regexErrorMessage', 'maxLength', 'minLength', 'max' and 'min' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "data"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "required": [
                  "dataFilter"
                ],
                "propertyNames": {
                  "not": {
                    "enum": [
                      "fields",
                      "choices",
                      "placeHolderText",
                      "regex",
                      "regexErrorMessage",
                      "max",
                      "min",
                      "maxLength",
                      "minLength"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'section' or 'text' then 'disabled', 'fields', 'updateRenderOnChange', 'classification', 'value', 'minValues', 'maxValues', 'minMaxValuesMessage', 'dataFilter', 'choices', 'placeHolderText', 'regex', 'regexErrorMessage', 'maxLength', 'minLength', 'max' and 'min' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "section",
                      "text"
                    ]
                  }
                },
                "required": [
                  "type"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "disabled",
                      "fields",
                      "updateRenderOnChange",
                      "classification",
                      "value",
                      "minValues",
                      "maxValues",
                      "minMaxValuesMessage",
                      "dataFilter",
                      "choices",
                      "regex",
                      "placeHolderText",
                      "regexErrorMessage",
                      "maxLength",
                      "minLength",
                      "max",
                      "min"
                    ]
                  }
                }
              }
            },
            {
              "if": {
                "description": "When type is 'fieldgroup' then 'fields' is required and then 'dataFilter', 'choices', 'placeHolderText', 'regex', 'regexErrorMessage', 'maxLength', 'minLength', 'max' and 'min' and 'emptyValuesAllowed' are not allowed",
                "properties": {
                  "type": {
                    "enum": [
                      "fieldgroup"
                    ]
                  }
                },
                "required": [
                  "type",
                  "fields"
                ]
              },
              "then": {
                "propertyNames": {
                  "not": {
                    "enum": [
                      "dataFilter",
                      "choices",
                      "placeHolderText",
                      "regex",
                      "regexErrorMessage",
                      "maxLength",
                      "minLength",
                      "max",
                      "min",
                      "emptyValuesAllowed"
                    ]
                  }
                }
              }
            }
          ]
        },
        "ica_pipeline_input_form_field_choice": {
          "$id": "#ica_pipeline_input_form_field_choice",
          "type": "object",
          "additionalProperties": false,
          "properties": {
            "value": {
            "description": "The value which will be set when selecting this choice. Must be unique over the choices within a field"
            },
            "text": {
              "description": "The display text for this choice, similar as the label of a field. ",
              "type": "string"
            },
            "selected": {
              "description": "Optional. When true, this choice value is picked as default selected value.  As in selected=true has precedence over an eventual set field 'value'. For clarity it's better however not to use 'selected' but use field 'value' as is used to set default values for the other field types.  Only maximum 1 choice may have selected true.",
              "type": "boolean"
            },
            "disabled": {
              "type": "boolean"
            },
            "parent": {
              "description": "Value of the parent choice item. Can be used to build hierarchical choice trees."
            }
          },
          "required": [
            "value",
            "text"
          ]
        }
      }
    }
    }
    ```json
    {
    ...
        "analysisOutput":
        [
            {
                "sourcePath": "out/test1",
                "type": "FOLDER",
                "targetProjectId": "4d350d0f-88d8-4640-886d-5b8a23de7d81",
                "targetPath": "/output-testing-01/"
            },
            {
                "sourcePath": "out/test2",
                "type": "FOLDER",
                "targetProjectId": "4d350d0f-88d8-4640-886d-5b8a23de7d81",
                "targetPath": "/output-testing-02/"
            }
        ]
    }
    ```

    Removed (❌). This version can not be selected when creating new pipelines and pipelines using this version will no longer work.

    ⚠️

    ❌

    v24.10

    ✅

    ✅

    ⚠️

    v25.10

    ⭐

    ⭐

    ✅

    v26.10

    ​

    ✅

    ⭐

    v27.10

    ​

    ​

    ✅

    Best for

    Ideal for critical workloads and urgent scaling needs.

    Best for cost optimization and non-critical workloads as interruptions can occur any time.

    v20.10

    ❌

    ❌

    ❌

    v22.04

    GUI

    Select the Nextflow version at Projects > your_project > flow > pipelines > your_pipeline > Details tab.

    API

    Select the Nextflow version by setting it in the optional field "pipelineLanguageVersionId". When not set, a default Nextflow version will be used for the pipeline.

    process ALIGN {
        cpus = 4
        memory = '16 GB'
        script:
        """
        your_command_here
        """
    }
    process {
        withName: ALIGN {
            cpus = 4
            memory = '16 GB'
        }
    }
    pod annotation: 'scheduler.illumina.com/presetSize', value: 'fpga2-medium'

    Pricing

    Fixed price per second with 60-second minimum.

    Cheaper than On-Demand.

    Availability

    Guaranteed capacity with Full control of starting, stopping, and terminating.

    Not guaranteed. Depends on unused AWS capacity. Can be terminated and reclaimed by AWS when the capacity is needed for other processes with 2 minutes notice.

    process foo {
        pod annotation: 'scheduler.illumina.com/lifecycle', value: "economy"
    }
    process.withName: PROCESS_NAME {
        pod.annotations = [
            'scheduler.illumina.com/lifecycle': 'economy'
        ]
    }
    publishDir 'out', mode: 'symlink'
    publishDir 'out', mode: 'link'
    executor.name
    executor.queueSize
    k8s.namespace
    k8s.serviceAccount
    k8s.launchDir
    k8s.projectDir
    k8s.workDir
    k8s.storageClaimName
    k8s.storageMountPath
    trace.enabled
    trace.file
    trace.fields
    timeline.enabled
    timeline.file
    report.enabled
    report.file
    dag.enabled
    dag.file
    process DRAGEN_PROCESS {
        pod annotation: 'scheduler.illumina.com/presetSize', value: 'fpga2-medium'
     
        script:
        """
        your_command_here
        """
    }
    process {
        withLabel: 'dragen' {
            pod = [
                annotation: 'scheduler.illumina.com/presetSize',
                value     : 'fpga2-medium'
            ]
        }
    }
    docker run <image> <tool> --help
    ENV PATH="/opt/conda/envs/myenv/bin:$PATH"  
    process MY_PROCESS {
        script:
           /opt/conda/envs/myenv/bin/bcftools view input.vcf > output.vcf
    }
    process {
        beforeScript = 'source /opt/conda/etc/profile.d/conda.sh && conda activate myenv'
    }
    NXF_CONTAINER_ENTRYPOINT_OVERRIDE=true

    Nextflow Version

    Compute Type

    Do not mix these definition methods within the same process2, use either one or the other method.

    CPU and Memory

    Predefined Sizes

    Often, there is a need to select the compute size for a process dynamically based on user input and other factors. The Kubernetes executor used on Platform Core does not use the cpu and memorydirectives, so instead, you can dynamically set the pod directive, as mentioned here. e.g.

    process foo {
        // Assuming that params.compute_size is set to a valid size such as 'standard-small', 'standard-medium', etc.
        pod annotation: 'scheduler.illumina.com/presetSize', value: "${params.compute_size}"
    }

    It can also be specified in the configuration file. See the example configuration below:

    // Set the default pod
    pod = [
        annotation: 'scheduler.illumina.com/presetSize',
        value     : 'standard-small'
    ]
    
    withName: 'big_memory_process' {
        pod = [
            annotation: 'scheduler.illumina.com/presetSize',
            value     : 'himem-large'
        ]
    }
    
    // Use an FPGA2 instance for dragen processes
    withLabel: 'dragen' {
        pod = [
            annotation: 'scheduler.illumina.com/presetSize',
            value     : 'fpga2-medium'
        ]
    }

    Standard vs Economy

    Concept

    Configuration

    Inputs

    Outputs

    Nextflow version 20.10.10 (Deprecated)

    Version 20.10 will be obsoleted on April 22nd, 2026. After this date, all existing pipelines using Nextflow v20.10 will no longer be able to run.

    For Nextflow version 20.10.10 on Platform Core, using the "copy" method in the publishDir directive for uploading output files that consume large amounts of storage may cause workflow runs to complete with missing files. The underlying issue is that file uploads may silently fail (without any error messages) during the publishDir process due to insufficient disk space, resulting in incomplete output delivery.

    Solutions:

    1. Use "" instead of "copy" in the publishDir directive. Symlinking creates a link to the original file rather than copying it, which doesn’t consume additional disk space. This can prevent the issue of silent file upload failures due to disk space limitations.

    2. Use Nextflow 22.04 or later and enable the "" publishDir option. This option ensures that the workflow will fail and provide an error message if there's an issue with publishing files, rather than completing silently without all expected outputs.

    Nextflow Configuration

    If no Docker image is specified, Ubuntu will be used as default.

    Best Practices

    Process Time

    Sample Sheet File Ingestion

    Migration

    Migrating from FPGA to FPGA2

    .nf

    nextflow.config

    Entrypoint

    Set PATH directly in the Dockerfile (Recommended)

    Use absolute paths in your pipeline

    Activate the environment in beforeScript

    Restore legacy behavior (deprecated — not recommended)

    predefined
    pod directive
    FPGA 2 medium
    AWS on-demand
    AWS spot instance
    JSON-based input
    XML input form
    tutorial
    publishDir directive
    Nextflow Configuration documentation
    time
    DRAGEN BSSH/ICA end of life roadmap
    draft
    released
    deprecated
    nextflowconfig-0

    ⚠️

    Automatic Shutdown Reminder

    The time (in days/hours) prior to the automatic shutdown at which an email reminder for this event is sent out to the workspace owner. For example: 1d 2h

    Docker image

    The list of docker images includes base images from Platform Core and images uploaded to the docker repository for that domain.

    Resource model

    Size of the machine on which the workspace will run.. See for available sizes.

    Description

    A place to provide additional information about the workspace.

    Storage size

    Represents the size of the storage available on the workspace. A storage from 1GB to 16TB can be provided.

    Access (available after selecting Docker image)

    The options here are determined by the . The options you select will become available on the details tab of the Workspace when it is running. Web allows to interact with the workspace via a browser. Console provides a terminal to interact with the workspace.

    Cluster

    When your selected Docker image is , the cluster settings become available. If you do not enable the cluster settings, the cluster-compatible image will be run on a single node. When enabled, you can choose if you want to use a dedicated cluster manager and if it requires web access.

    You can choose to use the same Docker image for the cluster manager and cluster members (default) or to use a separate Docker image for the cluster manager and the members.

    For the cluster members, you can choose to use a static amount of nodes or dynamic scaling, which resources (cpu, memory, storage and ephemeral storage) are required and if you want to run in economy mode (AWS ). AWS can interrupt Spot Instances with a two-minute notification which is passed on to the workspace which in turn grants a 30 second graceful shutdown period, so it is best not to use spot Instances for workloads that cannot handle individual instance interruption. For more information on clusters, see , / .

    Internet Access

    Type of access to the internet which should be provided for this workspace. Open: Internet access is allowed. Restricted: Creates a workspace with no internet access. Access to the Platform Core project data is still available in this mode. Whitelisted URLs: Specify URLs(*1) and paths that are allowed in a restricted workspace. Separate URLS with a new line. Only domains and subdomains in the specified URL will be allowed.

    Permissions

    Access limited to workspace owner. (*2)(Default) When this field is selected, only the workspace owner can access the workspace. Everything created in that workspace will belong to the workspace owner. The workspace itself will have the same permission rights to the , and as the person who starts the workspace has at that time.

    If you deselect the checkbox, you can grant access to the workspace to other users. In this case, the following options become configurable:

    • Project, Flow and Base access permission. Your workspace will operate with these . For security reasons, users will need to have permissions matching or exceeding what you set here, regardless of their role.

    Administrator

    X

    X

    X

    when permissions match those of the workspace

    Base (No Access - Viewer - Contributor)

    Wait until the status is “Running” and the “Access” tab can be opened. This can take some time because the necessary resources have to be provisioned.
    Code: The Docker file commands must be provided in this section.
  • Click the Docker Build tab.

    • Here the image that accompanies the tool will be created.

    • Change the name for the image.

    • Change the version.

    • Replace the description to describe what the image does.

    • Below the line where it says “#Add your commands below.” write the code necessary for running this docker image.

  • Click the General tab. This tab and all next tabs will look familiar from Flow. Enter the information required for the tool in each of the tabs. For more detailed instruction check out the Tool creation section in the Flow documentation.

  • Click the Save button in the upper, right-hand corner to start the build process.

  • Name

    must be a unique name

    Automatic Restart Reminder

    The time (in days/hours) prior to an automatic restart (every 30 days) at which an email reminder for this event is sent out to the workspace owner. For example: 1d 2h

    Automatic Shutdown

    The time (in days/hours) between start of the workspace and automatic shutdown. For example: 5d 12h. When this value is more than 30 days, which is the restart period, the workspace will be restarted after 30 days and the remaining time will be counted in the next cycle. So for 50 days, you will have a restart after 30 days and then 20 days remaining before the workspace shuts down.

    Contributor

    -

    -

    X

    when permissions match those of the workspace

    (*1) URLs must comply with the following rules:

    • URLs can be between 1 and 263 characters including dot (.).

    • URLs can begin with a leading dot (.).

    • Domain and Sub-domains:

      • Can include alphanumeric characters (Letters A-Z and digits 0-9). Case insensitive.

      • Can contain hyphens (-) and underscores (_), but not as a first or last character.

    • Dot (.) must be placed after a domain or sub-domain.

    • If you use a trailing slash like in the path ftp.example.net/folder/ then you will not be able to access the path ftp.example.net/folder without the trailing slash included.

    • Regex for URL : [(http(s)?):\/\/(www\.)?a-zA-Z0-9@:%._\+~#=-]\{2,256}\.[a-z]\{2,6}\b([-a-zA-Z0-9@:%_\+.~#?&\/\/=]*)

    (*2) When you grant workspace access to multiple users, you need to provide an API key to access the workspace. Authenticate using icav2 config set command. The CLI will prompt for an x-api-key value. enter the API Key generated from the product dashboard. See here for more information.

    (*2) If you want to use an ODBC connection in R to base, you need to set Access limited to workspace owner as user credentials are only injected in the user context under the path stored in environment variable USER_TOKEN_PATH when this setting is enabled. Since 2.42, API keys are no longer exposed in the environment. Use the following syntax to fetch the credentials in the correct format:

    JWT_TOKEN = trimws(readLines(Sys.getenv("USER_TOKEN_PATH"), warn = FALSE)[1]) This line removes whitespaces and obtains the token file which contains the credentials.

    "Authorization" = paste0("Bearer ", JWT_TOKEN) handles the format changes in the user credentials which are now bearer tokens as opposed to API keys in previous version.

    Example URLs

    The following are example URLs which will be considered valid.

    example.com www.example.com https://www.example.com subdomain.example.com subdomain.example.com/folder subdomain.example.com/folder/subfolder sub-domain.example.com sub_domain.example.com example.co.uk subdomain.example.co.uk sub-domain.example.co.uk\

    Example data science-specific whitelist compatible with restricted Bench workspaces. There are two required URLs to allow for Python pip installs:

    pypi.org files.pythonhosted.org repo.anaconda.com conda.anaconda.org github.com cran.r-project.org bioconductor.org www.npmjs.com mvnrepository.com\

    Workspace permissions

    Administrator vs Contributor

    Setting Workspace Permissions

    For security reasons, the Tenant administrator and Project owner can always access the workspace.

    If one of your permissions is not high enough as bench contributor, you will see the following message "You are not allowed to use this workspace as your user permissions are not sufficient compared to the permissions of this workspace".

    Workspaces which were created before this functionality existed can be upgraded by enabling these workspace permissions. If the workspaces are not upgraded, they will continue working as before.

    Delete workspace (Bench Administrators Only)

    Start workspace

    As long as the workspace is running, the resources provided for this workspace will be charged.

    GUI

    You can edit running workspaces to update the shutdown timer, shutdown reminder and auto restart reminder.

    If you want to open a running workspace in a new tab, then select the link at Projects > your_project > Bench > Workspaces > Details tab > Access. You can also copy the link with the copy symbol in front of the link.

    Stop workspace

    Storage will continue to be charged until the workspace is deleted. Administrators have a delete option for the workspace in the exit screen.

    Workspace Tabs

    Access tab

    Docker Builds tab (Bench Administrators only)

    The Dockerfile commands are all run as ROOT, so it is possible to delete or interfere with an image in such a way that the image is no longer running correctly. The image does not have access to any underlying parts of the platform so will not be able to harm the platform, but inoperable Bench images will have to be deleted or corrected.

    Tools (Bench Administrators Only)

    Workspace Data

    Activity tab

    teams
    permissions you set on the workspace level
    Automatic Shutdown
    CLI command
    non-indexed folders
    CLI command
    File Mapping

    We can investigate if subjects with PIK3CA mutations have changes in PIK3CA RNA Expression?

  • Click the Gene Expression tab, search for PIK3CA

    • PIK3CA RNA is down-regulated in 27% of the subjects relative to normal samples.

      1. Switch from normal to disease Reference where the Subject’s denominator is the median of all disease samples in your cohort.

      2. The count of matching vs. total subjects that have PIK3CA up-regulated RNA which may indicate a distinctive sub-phenotype.

  • Click on the PIK3CA gene link in the Gene Expression table.

  • You are shown the Gene tab under the Gene Summary sub-tab that lists information and links to public resources about PIK3CA.

  • Click the Variants tab and Show legend and filters if it does not open by default.

  • Below the interactive legend you see a set of analysis tracks: Needle Plot, Primate AI, Pathogenic variants, and Exons.

  • The Needle Plot allows toggling the plot by gnomAD frequency and Sample Count. Select Sample Count in the Plot by legend above the plot.

    • There are 87 mutations distributed across the 1068 amino acid sequence, listed below the analysis tracks. These can be exported via the icon into a table.

  • We know that missense variants can severely disrupt translated protein activity. Deselect all Variant Types except for Missense from the Show Variant Type legend above the needle plot.

    • Many mutations are in the functional domains of the protein as seen by the colored boxes and labels on the x-axis of the Needle Plot.

  • Hover over the variant with the highest sample count in the yellow PI3Ka protein domain.

    • The pop-up shows variant details for the 64 Subjects observed with it: 63 in the Breast Cancer study and 1 in the Ovarian Cancer Study.

  • Use the Exon zoom bar from each end of the Amino Acid sequence to zoom in to the PI3Ka domain to better separate observations.

  • There are three different missense mutations at this locus changing the wildtype Glutamine at different frequencies to Lysine (64), Glycine (6), or Alanine (2).

  • The Pathogenic Variant Track shows 7 ClinVar entries for mutations stacked at this locus affecting amino acid 545. Pop up details with pathogenicity calls, phenotypes, submitter and a link to the ClinVar entry is seen by hovering over the purple triangles.

  • Look at the Primate AI track and high Primate AI score.

    • Primate AI track displays scores for potential missense variants, based on polymorphisms observed in primate species. Points above the dashed line for the 75th percentile may be considered likely pathogenic as cross-species sequence is highly conserved; you often see high conservancy at the functional domains. Points below the 25th percentile may be considered "likely benign".

  • Click the Expression tab and notice that normal Breast and normal Ovarian tissue have relatively high PIK3CA RNA Expression in GTex RNAseq tissue data but ubiquitously expressed.

  • Disease Type, Histological Diagnosis, Technology, Overall Survival have interesting data about this cohort.

    The subject is a 35 year old Female with vital status and other phenotypes that feed up into the Subject attribute selection criteria when creating or editing cohorts.

    Data Analysis, Multi-Omic Biomarker Discovery, and Interpretation

    Tool Repository

    A Tool is the definition of a containerized application with defined inputs, outputs, and execution environment details including compute resources required, environment variables, command line arguments, and more.

    Create a Tool

    Tools define the inputs, parameters, and outputs for the analysis. Tools are available for use in graphical Common Workflow Language (CWL) pipelines by any project in the account.

    1. Select System Settings > Tool Repository > + Create.

    2. Configure tool settings in the tool properties tabs. See Tool Properties.

    3. Select Save.

    The following sections describe the tool properties that can be configured in each tab.

    Field
    Entry

    The tool release status can be set to Draft, Release Candidate, Released or Deprecated.

    The Building and Build Failed options are set by the application and not during configuration.

    Status
    Description

    The General provides options to configure the basic command line.

    Field
    Entry

    The Hints/Requirements include CWL features to indicate capabilities expected in the Tool's execution environment.

    • Inline Javascript

      • The Tool contains a property with a JavaScript expression to resolve it's value.

    • Initial workdir

    The Arguments tab provides options to configure base command parameters that do not require user input.

    Tool arguments may be one of two types:

    • String or Expression — A literal string or JavaScript expression, eg --format=bam.

    • Binding — An argument constructed from the binding of an input parameter.

    The following table describes the argument input fields.

    Field
    Entry
    Type

    Example

    Field
    Value

    The Inputs tab provides options to define the input files and folders for the tool. The following table describes the input and binding fields. Selecting multi value enables type binding options for adding prefixes to the input.

    Field
    Entry

    The Settings tab provides options to define parameters that can be set at the time of execution. The following table describes the input and binding fields. Selecting multi value enables type binding options for adding prefixes to the input.

    Field
    Entry

    The Outputs tab provides options to define the parameters of output files.

    The following table describes the input and binding fields. Selecting multi value enables type binding options for adding prefixes to the input.

    Field
    Entry

    As long as your tool is still in draft mode, you can edit it. Once released, you need to clone it to have an editable copy.

    1. From the System Settings > Tool Repository page, select a tool.

    2. Select Edit.

    1. From the System Settings > Tool Repository page, select a tool.

    2. Select the Information tab.

    3. From the Status drop-down menu, select a status.

    In addition to the interactive Tool builder, the platform GUI also supports working directly with the raw definition on the right hand side of the screen when developing a new Tool. This provides the ability to write the Tool definition manually or bring an existing Tool's definition to the platform.

    A simple example CWL Tool definition is provided below.

    After pasting into the editor, the definition is parsed and the other tabs for visually editing the Tool will populate according to the definition contents.

    • General Tool - includes your base command and various optional configurations.

      • The base command is required for your tool to run, e.g. python /path/to/script.py such that python and /path/to/script.py are added in separate lines.

    • How to reference your tool inputs and settings throughout the tool definition?

      • You can either reference your inputs using their position or ID.

        • Settings can be referenced using their defined IDs, e.g. $(inputs.InputSetting)

    onFinished.js

    The onFinished JavaScript functionality allows you to execute custom JavaScript code automatically after a pipeline analysis completes. It runs when the analysis completes successfully and provides access to the analysis inputs, outputs, and pipeline settings through a JavaScript execution environment. You can use this to perform post-processing tasks such as linking output files to samples.

    1. Create a JavaScript file named onFinished.js in your pipeline.

    2. Define a function called onFinished that accepts an

    symlink
    failOnError

    Length between 1 and 63 characters.

    Download/Upload
    allowed
    Bench pricing
    Docker image settings
    cluster compatible
    spot instances
    Bench Clusters
    Sun Grid Engine
    Spark
    project
    flow
    base
    permissions
    input
    parameter
  • The function will be called automatically when your analysis completes

  • The input parameter provides access to analysis context and results:

    Information about the pipeline that was executed:

    • name - Pipeline name

    • version - Pipeline version string

    • tenant - Tenant name

    • description - Pipeline description

    Information about the analysis execution:

    • userReference - User-defined reference/name for the analysis

    • owner - Username of the analysis owner

    • tenant - Tenant name

    • status - Current analysis status

    The pipeline input form configuration used for this analysis.

    A map of the actual input values provided when launching the analysis. Keys correspond to pipeline input parameter codes.

    Example:

    A map of pipeline output parameters to their resulting data files. Keys are output parameter codes, values are arrays of data objects.

    Each data object contains:

    • id - Data file identifier

    • name - Data file name

    • path - Full path to the data file

    • format - Data format code (e.g., "BAM", "FASTQ", "VCF")

    • size - File size in bytes (-1 if unknown)

    • folder - Boolean indicating if this is a folder

    • sampleIds - Array of sample UUIDs associated with this data

    A map of sample objects referenced in the analysis inputs. Keys in the map are sample UUID, and every sample object contains:

    • id - the UUID identifier

    • name - Data file name

    • instrumentRunIds - list of instrument run ids

    The onFinish environment provides a number functions (searchSamples, searchData and linkDataToSamples) for post-processing operations:

    Search for samples by ID or name.

    • Object with one or both (at least one parameter must be provided) of:

      • id - Sample UUID to search for

      • name - Exact sample name to search for

    Array of sample objects, where each sample contains:

    • id - Sample UUID

    • name - Sample name

    • instrumentRunIds - Array of instrument run IDs associated with this sample

    Errors are automatically printed to the logs. The function returns null on error.


    Search for data files in your analysis outputs with flexible filtering options.

    Object with optional filters:

    • parent - Data object to use as parent (searches within this folder/path)

    • recursive - Boolean, if true searches recursively from parent path (default: true)

    • pathRegex - Regular expression to filter by file path (case-insensitive)

    • nameRegex - Regular expression to filter by file name (case-insensitive)

    Array of data objects, where each data contains:

    • id - Data file identifier

    • name - File name

    • path - Full file path

    • format - Data format code

    • size - File size in bytes

    • folder - Boolean indicating if this is a folder

    • sampleIds - Array of associated sample UUIDs

    • Find specific output files by pattern

    • Navigate through output folder structures

    • Filter files by type or naming convention

    • Locate files for further processing


    Link an output data file to a sample, establishing the relationship between analysis outputs and samples.

    Object with two required properties:

    • data - Data object (from input.outputs or searchDatas())

    • sample - Sample object (from input.samples or searchSamples())

    None. The function establishes the link in the system.

    • Associate output files with input samples

    • Track which files belong to which samples

    • Enable sample-centric data organization

    • Facilitate downstream sample-based queries

    If the data or sample cannot be found, or if the linking fails, an error message is automatically printed to the logs.


    This example demonstrates a typical post-processing workflow:

    link output files to the same sample to which the input file with the same name was linked.

    Linking output files to a sample for which there is a textbox('targetSampleName') for the sample name in the inputform.

    Check if results exist before processing:

    Use print() statements to provide visibility into your post-processing:

    Verify array contents before iteration:

    After the analysis completes, the onFinish execution logs are available in the analysis details screen to users with edit rights on the pipeline. All print() statements and error messages will appear in these logs.

    Usage

    Creating an onFinish Script

    Basic Structure

    Input Object

    Injected Functions

    searchSamples()

    Syntax:

    Parameters:

    Returns:

    Example:

    Error Handling:

    searchDatas()

    Syntax:

    Parameters:

    Returns:

    Examples:

    Use Cases:

    linkDataToSample()

    Syntax:

    Parameters:

    Returns:

    Example:

    Use Cases:

    Error Handling:

    Full Example

    Linking to Sample

    Linking with Textbox

    Linking Output Folders to Samples

    Best Practices

    Error Handling

    Logging

    Iterate Safely

    Debugging

    Viewing Logs

    Advanced Use Cases

    Conditional Linking Based on File Attributes

    function onFinished(input) {
        // Your post-processing logic here
        print("Analysis completed!");
        
        // Access analysis information
        print("Pipeline: " + input.pipeline.name);
        print("Analysis status: " + input.analysis.status);
    }
    input.pipeline
    input.analysis
    input.currentAnalysisSettings
    input.settingValues
    // Access input parameter values
    var sampleId = input.settingValues.sample_id;
    var threshold = input.settingValues.quality_threshold;
    input.outputs
    input.samples
    var samples = searchSamples({
        id: "sample-uuid",        // Optional: Search by sample UUID
        name: "sample-name"       // Optional: Search by exact sample name
    });
    // Search by sample ID
    var samples = searchSamples({ id: "550e8400-e29b-41d4-a716-446655440000" });
    
    // Search by sample name
    var samples = searchSamples({ name: "SAMPLE_001" });
    
    // Check results
    if (samples && samples.length > 0) {
        samples.forEach(function(sample) {
            print("Found sample: " + sample.name + " (ID: " + sample.id + ")");
        });
    } else {
        print("No samples found");
    }
    var datas = searchDatas({
        parent: dataObject,       // Optional: Parent folder/data to search within
        recursive: true,          // Optional: Search recursively (default: true)
        pathRegex: ".*\\.bam",  // Optional: Regex to match file paths
        nameRegex: ".*output.*"   // Optional: Regex to match file names
    });
    // Search for all BAM files in outputs
    var bamFiles = searchDatas({
        nameRegex: ".*\\.bam$"
    });
    
    // Search within a specific output folder
    var outputFolder = input.outputs.results[0];
    var resultsFiles = searchDatas({
        parent: outputFolder,
        recursive: true
    });
    
    // Find files matching a pattern in a specific path
    var reportFiles = searchDatas({
        pathRegex: ".*/reports/.*",
        nameRegex: ".*\\.html$"
    });
    
    // Process results
    if (bamFiles && bamFiles.length > 0) {
        print("Found " + bamFiles.length + " BAM files:");
        bamFiles.forEach(function(file) {
            print("  - " + file.name + " at " + file.path);
        });
    }
    linkDataToSample({
        data: dataObject,      // Required: Data object to link
        sample: sampleObject   // Required: Sample object to link to
    });
    // Link output BAM files to their corresponding samples
    var outputBams = input.outputs.output_bam;
    
    if (outputBams && outputBams.length > 0) {
        outputBams.forEach(function(bam) {
            // Extract sample name from BAM filename
            var sampleName = bam.name.replace(/\.bam$/, "");
            
            // Find the corresponding sample
            var samples = searchSamples({ name: sampleName });
            
            if (samples && samples.length > 0) {
                var sample = samples[0];
                
                // Link the BAM file to the sample
                linkDataToSample({
                    data: bam,
                    sample: sample
                });
                
                print("Linked " + bam.name + " to sample " + sample.name);
            } else {
                print("Warning: No sample found for " + bam.name);
            }
        });
    }
    function onFinished(input) {
        print("=== Post-Analysis Processing Started ===");
        print("Pipeline: " + input.pipeline.name + " v" + input.pipeline.version);
        print("Analysis: " + input.analysis.userReference);
        
        // 1. Search for BAM files in the outputs
        print("\n--- Searching for BAM files ---");
        var bamFiles = searchDatas({
            nameRegex: ".*\\.bam$"
        });
        
        if (!bamFiles || bamFiles.length === 0) {
            print("No BAM files found in outputs");
            return;
        }
        
        print("Found " + bamFiles.length + " BAM file(s)");
        
        // 2. Link each BAM file to its corresponding sample
        print("\n--- Linking BAM files to samples ---");
        bamFiles.forEach(function(bam) {
            // Extract sample name from filename (assumes format: SAMPLENAME.bam)
            var fileBaseName = bam.name.replace(/\.bam$/, "");
            
            print("Processing: " + bam.name);
            
            // Search for the sample
            var samples = searchSamples({ name: fileBaseName });
            
            if (samples && samples.length > 0) {
                var sample = samples[0];
                
                // Create the link
                linkDataToSample({
                    data: bam,
                    sample: sample
                });
                
                print("  ✓ Successfully linked to sample: " + sample.name);
            } else {
                print("  ✗ Warning: No matching sample found for " + fileBaseName);
            }
        });
        
        // 3. Generate summary
        print("\n--- Summary ---");
        print("Total outputs processed: " + bamFiles.length);
       
        // List all output parameters
        for (var outputCode in input.outputs) {
            var outputData = input.outputs[outputCode];
            print("Output parameter '" + outputCode + "': " + outputData.length + " file(s)");
        }
        
        print("\n=== Post-Analysis Processing Completed ===");
    }
    function onFinished(input) {
        print("hello, i'm inside the onFinished function");
        print("input = " + input);
    
        var inputFiles = input.settingValues["in"];
    
        var outputDatas = searchDatas({});
        print("outputDatas = " + outputDatas);
    
        for (const outputdata of outputDatas) {
            var inputFile = find(inputFiles, outputdata.name);
            if (inputFile && inputFile.sampleIds) {
                for (const sampleId of inputFile.sampleIds) {
                    linkDataToSample({"data": outputdata, "sample": input.samples[sampleId]});
                }
            }
        }
    }
    
    
    function find(inputFiles, name) {
        for (const inputFile of inputFiles) {
            if (inputFile.name == name) {
                return inputFile;
            }
        }
        return null;
    }
    function onFinished(input) {
        print("hello, i'm inside the onFinished function");
        print("input = " + input);
        var targetSampleName = input.settingValues["targetSampleName"];
        print("targetSampleName = " + targetSampleName);
        
        var validationErrors = [];
    
        var outputDatas = searchDatas({"nameRegex": ".*.txt"});
        print("outputDatas = " + outputDatas);
        
        var samples = searchSamples({"name": targetSampleName});
        print("samples = " + samples);
        
        for (const outputdata of outputDatas) {
            for (const sample of samples) {
                linkDataToSample({"data": outputdata, "sample": sample});
            }
        }
    }
    // When analysis outputs contain per-sample folders with multiple files
    // Link each folder to its corresponding sample based on folder name
    
    function onFinished(input) {
        print("=== Linking Sample Folders ===");
        
        var sampleFolders = getSampleOutputFolders(input);
        if (!sampleFolders || sampleFolders.length === 0) {
            print("No sample folders found in outputs");
            return;
        }
        
        print("Found " + sampleFolders.length + " output folder(s)");
        
        var successCount = 0;
        var failureCount = 0;
        
        sampleFolders.forEach(function(folder) {
            // Only process folders (not individual files)
            if (!folder.folder) {
                print("Skipping non-folder item: " + folder.name);
                return;
            }
            
            print("\nProcessing folder: " + folder.name);
            
            // Extract sample name from folder name
            // Assumes folder naming convention like: "SAMPLE_001_results" or "SAMPLE_001"
            var folderName = folder.name;
            
            // Method 1: Direct match (folder name is sample name)
            var sampleName = folderName;
            
            // Method 2: Extract from pattern (e.g., "SAMPLE_001_results" -> "SAMPLE_001")
            // Uncomment and adjust pattern as needed:
            // var match = folderName.match(/^(.+?)_results$/);
            // if (match) {
            //     sampleName = match[1];
            // }
            
            // Method 3: Remove suffix/prefix
            // sampleName = folderName.replace(/_results$/, "");
            
            print("  Looking for sample: " + sampleName);
            
            // Search for the sample
            var samples = searchSamples({ name: sampleName });
            
            if (samples && samples.length > 0) {
                var sample = samples[0];
                
                // Link the entire folder to the sample
                linkDataToSample({
                    data: folder,
                    sample: sample
                });
                
                print("  Successfully linked folder '" + folder.name + "' to sample '" + sample.name + "'");
                
                successCount++;
            } else {
                print("  Warning: No matching sample found for '" + sampleName + "'");
                failureCount++;
            }
        });
        
        // Summary
        print("\n=== Summary ===");
        print("Successfully linked: " + successCount + " folder(s)");
        print("Failed to link: " + failureCount + " folder(s)");
        print("Total processed: " + sampleFolders.length + " folder(s)");
    }
    
    
    function getSampleOutputFolders(input) {
    var outputfolder = input.outputs["Output"][0];
    print("outputfolder=" + outputfolder);
    var firstLevelFilesAndFolders = searchDatas({
    "parent": outputfolder,
    "recursive": false
    });
    
    print("firstLevelFilesAndFolders=" + firstLevelFilesAndFolders);
    var sampleOutputFolders = [];
    
    firstLevelFilesAndFolders.forEach(function (firstLevelFileOrFolder) {
    if (firstLevelFileOrFolder.folder == true && "reports" != firstLevelFileOrFolder.name) {
    sampleOutputFolders.push(firstLevelFileOrFolder);
    }
    }
    );
    
    print("sampleOutputFolders=" + sampleOutputFolders);
    
    return sampleOutputFolders;
    }
    var samples = searchSamples({ name: sampleName });
    if (samples && samples.length > 0) {
        // Process samples
    } else {
        print("Warning: No samples found");
    }
    print("Starting sample linking for " + bamFiles.length + " files");
    if (outputBams && outputBams.length > 0) {
        outputBams.forEach(function(bam) {
            // Process BAM file
        });
    }
    // Only link BAM files larger than 1GB
    var largeFiles = searchDatas({ nameRegex: ".*\\.bam$" })
        .filter(function(file) {
            return file.size > 1000000000; // 1GB in bytes
        });
    
    print("Processing " + largeFiles.length + " large BAM files");
    // ... continue with linking logic

    Status

    The release of the tool.

    Docker image

    The registered Docker image for the tool.

    Categories

    One or more tags to categorize the tool. Select from existing tags or type a new tag name in the field.

    Tool version

    The version of the tool specified by the end user. Could be any string.

    Release version

    The version number of the tool.

    Version comment

    A description of changes in the updated version.

    Links

    External reference links.

    Documentation

    The Documentation field provides options for configuring the HTML description for the tool. The description appears in the Tool Repository but is excluded from exported CWL definitions.

    Deprecated

    The tool is no longer intended for use in pipelines. but there are no restrictions placed on the tool. That is, it can still be added to new pipelines and will continue to work in existing pipelines. It is merely an indication to the user that the tool should no longer be used.

    Standard out

    The name of the file where the Standard Out (STDOUT) stream information will be stored.

    Standard error

    The name of the file where the Standard Error (STDERR) stream information will be stored.

    Requirements

    The requirements for triggering an error message. (see below)

    Hints

    The requirements for triggering a warning message. (see below)

    The workdir can be any of the following types:
    • String or Expression — A string or JavaScript expression, eg, $(inputs.InputFASTA)

    • File or Dir — A map of one or more files or directories, in the following format: {type: array, items: [File, Directory]}

    • Dirent — A script in the working directory. The Entry name field specifies the file name.

  • Scatter feature — Indicates that the workflow platform must support the scatter and scatterMethod fields.

  • Prefix

    The string prefix.

    Binding

    Item separator

    The separator that is used between array values.

    Binding

    Value from

    The source string or JavaScript expression.

    Binding

    Separate

    The setting to require the Prefix and Value from fields to be added as separate or combined arguments. Tru indicates the fields must be added as separate arguments. False indicates the fields must be added as a single concatenated argument.

    Binding

    Shell quote

    The setting to quote the Value from field on the command line. True indicates the value field appears in the command line. False indicates the value field is entered manually.

    Binding

    Output file

    SRR45678_sorted.bam

    Type

    The input type, which can be either a file or a directory.

    Input options

    Optional indicates the input is optional. Multi value indicates there is more than one input file or directory. Streamable indicates the file is read or written sequentially without seeking.

    Secondary files

    The required secondary files or directories.

    Format

    The input file format.

    Position

    The position of the argument in the final command line. If the position is not specified, the default value is set to 0 and the arguments appear in the order they were added.

    Prefix

    The string prefix.

    Item separator

    The separator that is used between array values.

    Value from

    The source string or JavaScript expression.

    Load contents

    The setting to require the Prefix and Value from fields to be added as separate or combined arguments. True indicates the fields must be added as separate arguments. False indicates the fields must be added as a single concatenated argument.

    Separate

    The setting to require the Prefix and Value from fields to be added as separate or combined arguments. True indicates the fields must be added as separate arguments. False indicates the fields must be added as a single concatenated argument.

    Shell quote

    The setting to quote the Value from field on the command line. True indicates the value field appears in the command line. False indicates the value field is entered manually.

    Type

    The input type, which can be Boolean, Int, Long, Float, Double or String.

    Default Value

    The default value to use if the tool setting is not available.

    Input options

    Optional indicates the input is optional. Multi value indicates there can be more than one value for the input.

    Position

    The position of the argument in the final command line. If the position is not specified, the default value is set to 0 and the arguments appear in the order they were added.

    Prefix

    The string prefix.

    Item separator

    The separator that is used between array values.

    Value from

    The source string or JavaScript expression.

    Separate

    The setting to require the Prefix and Value from fields to be added as separate or combined arguments. True indicates the fields must be added as separate arguments. False indicates the fields must be added as a single concatenated argument.

    Shell quote

    The setting to quote the Value from field on the command line. True indicates the value field appears in the command line. False indicates the value field is entered manually.

    Type

    The input type, which can be either a file or a directory.

    Output options

    Optional indicates the input is optional. Multi value indicates here is more than one input file or directory. Streamable indicates the file is read or written sequentially without seeking.

    Secondary files

    The required secondary files or folders.

    Format

    The input file format.

    Globs

    The pattern for searching file names.

    Load contents

    Automatically loads some contents. The system extracts up to the first 64 KiB of text from the file. Populates the contents field with the first 64 KiB of text from the file.

    Output eval

    Evaluate an expression to generate the output value.

    Select Save.
    Inline Javascript requirement - must be enabled if you are using Javascript anywhere in your tool definition.
  • Initial workdir requirement - Dirent Type

    • Your tool must point to a script that executes your analysis. That script can either be provided in your Docker image or using a Dirent. Defining a script via Dirent allows you to dynamically modify your script without updating your Docker image. In order to define your Dirent script define your script name under Entry name (e.g. runner.sh) and the script content under Entry. Then, point your base command to that custom script, e.g. bash runner.sh.

  • File/Folder inputs can be referenced using their defined IDs, followed by the desired field, e.g. $(inputs.InputFile.path). For additional information please refer to the File CWL documentation.

  • All inputs can also be referenced using their position, e.g. bash script.sh $1 $2

  • Name

    The name of the tool.

    Description

    Free text description for information purposes.

    Icon

    The icon for the tool.

    Draft

    Fully editable draft.

    Release Candidate

    The tool is ready for release. Editing is locked but the tool can be cloned to create a new version.

    Released

    The tool is released. Tools in this state cannot be edited. Editing is locked but the tool can be cloned to create a new version.

    ID

    CWL identifier field

    CWL version

    The CWL version in use. This field cannot be changed.

    Base command

    Components of the command. Each argument must be added in a separate line.

    Value

    The literal string to be added to the base command.

    String or expression

    Position

    The position of the argument in the final command line. If the position is not specified, the default value is set to 0 and the arguments appear in the order they were added.

    Binding

    Prefix

    --output-filename

    Value from

    $(inputs.inputSAM.nameroot).bam

    Input file

    /tmp/storage/SRR45678_sorted.sam

    ID

    The file ID.

    Label

    A short description of the input.

    Description

    A long description of the input.

    ID

    The file ID.

    Label

    A short description of the input.

    Description

    A long description of the input.

    ID

    The file ID.

    Label

    A short description of the input.

    Description

    A long description of the input.

    #!/usr/bin/env cwl-runner
    
    cwlVersion: v1.0
    class: CommandLineTool
    label: echo
    inputs:
      message:
        type: string
        default: testMessage
        inputBinding:
          position: 1
    outputs:
      echoout:
        type: stdout
    baseCommand:
    - echo

    Refer to the CWL CommandLineTool Specification for further explanation about many of the properties described below. Not all features described in the specification are supported.

    Details Tab

    Tool Status

    General Tab

    Arguments Tab

    Inputs Tab

    Settings Tab

    Outputs Tab

    Edit a Tool

    Update Tool Status

    Creating definitions without the wizard

    Be careful when editing the raw tool definition as this can introduce errors.

    Creating Your First Tool - Tips and Tricks

    The difference between Settings and Arguments: Settings are exposed at the pipeline level with the ability to get modified at launch, while Arguments are intended to be immutable and hidden from users launching the pipeline.

    Notifications

    Notifications (Projects > your_project > Project Settings > Notifications ) are events to which you can subscribe. When they are triggered, they deliver a message to an external target system such as emails, Amazon SQS or SNS systems or HTTP post requests. The following table describes available system events to which you can subscribe:

    Description
    Code
    Details
    Payload

    Analysis failure

    When you subscribe to overlapping event codes such as ICA_EXEC_002 (analysis success) and ICA_EXEC_028 (analysis status change) you will get both notifications when analysis success occurs.

    Event notifications can be delivered to the following delivery targets:

    Delivery Target
    Description
    Value

    To create a subscription via the GUI, select Projects > your_project > Project Settings > Notifications > +Create > Platform Core event. Select an event from the dropdown menu and fill out the requested fields. Depending on the selected delivery targets, the fields will change.

    Once created, you can disable, enable or delete the notification subscriptions at Projects > your_project > Project Settings > Notifications.

    In order to allow the platform to deliver events to Amazon SQS or SNS delivery targets, a cross-account policy needs to be added to the target Amazon service.

    Substitute the variables in the example above according to the table below.

    Variable
    Description

    See examples for setting policies in and .

    To create a subscription to deliver events to an Amazon SNS topic, you can use either the GUI or API endpoints.

    To create a subscription via the GUI, select Projects > your_project > Project Settings > Notifications > +Create > Platform Core event. Select an event from the dropdown menu, insert an optional filter, select the channel type (SNS), and then insert the ARN from the target SNS topic and the AWS region.

    To create a subscription via API, use the endpoint /api/notificationChannel to create a channel and then /api/projects/{projectId}/notificationSubscriptions to create a notification subscription.

    To create a subscription to deliver events to an Amazon SQS queue, you can use either GUI or API endpoints.

    To create a subscription via the GUI, select Projects > your_project > Project Settings > Notifications > +Create > Platform Core event.

    • Select an event from the dropdown menu

    • Choose SQS as the way to receive the notifications and enter your SQS URL.

    • Depending on the event, you can choose a payload version. Not all payload versions are applicable for all events and targets, so the system will filter the options out for you.

    To create a subscription via API, use the endpoint /api/notificationChannel to create a channel and then /api/projects/{projectId}/notificationSubscriptions to create a notification subscription.

    Messages delivered to AWS SQS contain the following event body attributes:

    Attribute
    Description

    The following example is a Data Updated event payload sent to an AWS SQS delivery target (condensed for readability):

    Notification subscriptions will trigger for all events matching the configured event type. A filter may be configured on a subscription to limit the matching strategy to only those event payloads which match the filter.

    The filter expressions leverage the library for describing the matching pattern to be applied to event payloads. The filter must be in the format [?(<expression>)].

    The Analysis Success event delivers a JSON event payload matching the Analysis data model (as output from the API to ).

    The below examples demonstrate various filters operating on the above event payload:

    • Filter on a pipeline, with a code that starts with ‘Copy’. You’ll need a regex expression for this:

      [?($.pipeline.code =~ /Copy.*/)]

    • Filter on status (note that the Analysis success event is only emitted when the analysis is successful):

      [?($.status == 'SUCCEEDED')]

    Examples for other events

    • Filtering ICA_DATA_104 on owning project name. The top-level keys on which you can filter are under the payload key, so payload is not included in this filter expression.

      [?($.details.owningProjectName == 'my_project_name')]

    Custom events let you trigger notification subscriptions using event that are not part of the system-defined event types. When creating a custom subscription, a custom event code can be specified to use within the project. Events can then be sent to the specified event code using a POST API with the request body specifying the event payload.

    Custom events can be defined using the API. To create a custom event for your project, follow the steps below:

    1. Create a new custom event POST {ICA_URL}/ica/rest/api/projects/{projectId}/customEvents a. Your custom event code must be 1-20 characters long, e.g. 'ICA_CUSTOM_123'. b. This event code will be used to reference that custom event type.

    2. Create a new notification channel POST {ICA_URL}/ica/rest/api/notificationChannels a. If there already is a notification channel with the desired configuration within the same project, you can get the existing channel ID using the call GET {ICA_URL}/ica/rest/api/notificationChannels.

    To create a subscription via the GUI, select Projects > your_project > Project Settings > Notifications > +Create > Custom event.

    Once the steps above have been completed successfully, the call from the first step POST {ICA_URL}/ica/rest/api/projects/{projectId}/customEvents could be reused with the same event code to continue sending events through the same channel and subscription.

    Below is a sample Python function used inside a Platform Core pipeline to post custom events for each failed metric:

    status
    Multi-Omic Cancer Workflow

    Sns

    AWS SNS Topic

    AWS SNS Topic ARN

    Http

    Webhook (POST request)

    URL

    Finally, you can enter a filter expression to get only those events are relevant for you. Only those events matching the expression will be received.

    description

    Description of the event

    payload

    Event payload

    Both payload Version V3 and V4 guarantee the presence of the final state (SUCCEEDED, FAILED, FAILED_FINAL, ABORTED) but depending on the flow (so not every intermediate state is guaranteed):

    • V3 can have status REQUESTED - IN_PROGRESS - SUCCEEDED

    • V4 can have status REQUESTED - QUEUED - INITIALIZING - PREPARING_INPUTS - IN_PROGRESS - GENERATING_OUTPUTS - SUCCEEDED

  • Filter on pipeline, having a technical tag “Demo":

    [?('Demo' in $.pipeline.pipelineTags.technicalTags)]

  • Combination of multiple expressions using &&. It's best practice to surround each individual expression with parentheses:

    [?(($.pipeline.code =~ /Copy.*/) && $.status == 'SUCCEEDED')]

  • Create a notification subscription POST {ICA_URL}/ica/rest/api/projects/{projectId}/customNotificationSubscriptions. a. Use the event code created in step 1. b. Use the channel ID from step 2.

    ICA_EXEC_001

    Emitted when an analysis fails

    Analysis

    Analysis success

    ICA_EXEC_002

    Emitted when an analysis succeeds

    Analysis

    Analysis aborted

    ICA_EXEC_027

    Emitted when an analysis is aborted either by the system or the user

    Analysis

    Analysis status change

    ICA_EXEC_028

    Emitted when an state transition on an analysis occurs

    Analysis

    Base Job failure

    ICA_BASE_001

    Emitted when a Base job fails

    BaseJob

    Base Job success

    ICA_BASE_002

    Emitted when a Base job succeeds

    BaseJob

    Data transfer success

    ICA_DATA_002

    Emitted when a data transfer is marked as Succeeded

    DataTransfer

    Data transfer stalled

    ICA_DATA_025

    Emitted when data transfer hasn't progressed in the past 2 minutes

    DataTransfer

    Data <action>

    ICA_DATA_100

    Subscribing to this serves as a wildcard for all project data status changes and covers those changes that have no separate code. This does not include DataTransfer events or changes that trigger no data status changes such as adding tags to data.

    ProjectData

    Data linked to project

    ICA_DATA_104

    Emitted when a file is linked to a project

    ProjectData

    Data can not be created in non-indexed folder

    ICA_DATA_105

    Emitted when attempting to create data in a non-indexed folder

    ProjectData

    Data deleted

    ICA_DATA_106

    Emitted when data is deleted

    ProjectData

    Data created

    ICA_DATA_107

    Emitted when data is created

    ProjectData

    Data uploaded

    ICA_DATA_108

    Emitted when data is uploaded

    ProjectData

    Data updated

    ICA_DATA_109

    Emitted when data is updated

    ProjectData

    Data archived

    ICA_DATA_110

    Emitted when data is archived

    ProjectData

    Data unarchived

    ICA_DATA_114

    Emitted when data is unarchived

    ProjectData

    Job status changed

    ICA_JOB_001

    Emitted when a job changes status (INITIALIZED, WAITING_FOR_RESOURCES, RUNNING, STOPPED, SUCCEEDED, PARTIALLY_SUCCEEDED, FAILED)

    JobId

    Sample completed

    ICA_SMP_002

    Emitted when a sample is marked as completed

    ProjectSample

    Sample linked to a project

    ICA_SMP_003

    Emitted when a sample is linked to a project

    ProjectSample

    Workflow session start

    ICA_WFS_001

    Emitted when workflow is started

    WorkflowSession

    Workflow session failure

    ICA_WFS_002

    Emitted when workflow fails

    WorkflowSession

    Workflow session success

    ICA_WFS_003

    Emitted when workflow succeeds

    WorkflowSession

    Workflow session aborted

    ICA_WFS_004

    Emitted when workflow is aborted

    WorkflowSession

    Mail

    E-mail delivery

    E-mail Address

    Sqs

    AWS SQS Queue

    AWS SQS Queue URL

    platform_aws_account

    The platform AWS account ID: 079623148045

    action

    For SNS use SNS:Publish. For SQS, use SQS:SendMessage

    arn

    The Amazon Resource Name (ARN) of the target SNS topic or SQS queue

    correlationId

    GUID used to identify the event

    timestamp

    Date when the event was sent

    eventCode

    Event code of the event

    When integrating with external systems, it is advised to not solely rely on Platform Core notifications, but to also add a polling system to check the status of long-running tasks. For example verifying the status of long-running (>24h) analyses with a 12 hour interval.

    Delivery Targets

    Subscribing to Notifications

    Subscriptions can only be deleted if there are no failed or pending notifications, so if the delete button is not available, look at the failed notifications details of the subscription. Projects > your_project > Project Settings > Notifications > your_notification > Delivery failed tab. From there, either reprocess or delete the failed notification so you can delete the notification subscription.

    Amazon Resource Policy Settings

    Amazon SNS Topic

    GUI

    API

    Amazon SQS Queue

    GUI

    API

    Filtering

    Examples

    Custom Events

    API

    GUI

    Amazon SQS
    Amazon SNS
    JsonPath
    retrieve a project analysis
    {
       "Version":"2012-10-17",
       "Statement":[
          {
             "Effect":"Allow",
             "Principal":{
                "AWS":"arn:aws:iam::<platform_aws_account>:root"
             },
             "Action":"<action>",
             "Resource": "<arn>"
          }
       ]
    }
    {
        "correlationId": "2471d3e2-f3b9-434c-ae83-c7c7d3dcb4e0",
        "timestamp": "2022-10-06T07:51:09.128Z",
        "eventCode": "ICA_DATA_100",
        "description": "Data updates",
        "payload": {
            "id": "fil.8f6f9511d70e4036c60908daa70ea21c",
            ...
        }
    }
     {
         "id": "0c2ed19d-9452-4258-809b-0d676EXAMPLE",
         "timeCreated": "2025-10-16T23:41:04Z",
         "timeModified": "2025-10-17T00:08:00Z",
         "owner":
             {
             "id": "15d51d71-b8a1-4b38-9e3d-74cdfEXAMPLE"
             },
         "tenant":
             {
             "id": "022c9367-8fde-48fe-b129-741a4EXAMPLE",
             "name": "ExampleTenant"
             },
         "reference": "210920-1-CopyToolDev-9d78096d-35f4-47c9-b9b6-e0cbcEXAMPLE",
         "userReference": "210920-1",
         "pipeline":
            {
                "id": "20261676-59ac-4ea0-97bd-8a684EXAMPLE",
                "urn": "urn:ilmn:ica:pipeline:20261676-59ac-4ea0-97bd-8a684EXAMPLE",
                "timeCreated": "2023-07-12T20:03:23Z",
                "timeModified": "2023-07-12T20:03:32Z",
                "owner":
                {
                    "id": "15d51d71-b8a1-4b38-9e3d-74cdfEXAMPLE"
                },
                "tenant":
                {
                    "id": "022c9367-8fde-48fe-b129-741a4EXAMPLE",
                    "name": "ExampleTenant"
                },
                "code": "CopyToolDev",
                "description": "Copy Tool Demonstration",
                "status": "RELEASED",
                "language": "NEXTFLOW",
                "languageVersion":
                {
                    "id": "b1585d18-f88c-4ca0-8d47-34f6c01eb6f3",
                    "name": "22.04.3",
                    "language": "NEXTFLOW"
                },
                "pipelineTags":
                {
                    "technicalTags":
                    ["Demo"]
                },
                "analysisStorage":
                {
                    "id": "6e1b6c8f-f913-4332-9bd0-7fc13eda0fd0",
                    "name": "Small",
                    "description": "1.2TB"
                },
                "proprietary": false,
                "inputFormType": "XML",
                "reportConfigs":
                {
                    "configs":
                    []
                }
            },
            "status": "SUCCEEDED",
            "startDate": "2025-10-16T23:41:22Z",
            "endDate": "2025-10-17T00:07:52Z",
            "analysisStorage":
            {
                "id": "6e1b6c8f-f913-4362-9bd0-7fc13eda0fd0",
                "name": "Small",
                "description": "1.2TB"
            },
            "analysisPriority": "HIGH",
            "tags":
            {
                "technicalTags":
                [],
                "userTags":
                [],
                "referenceTags":
                []
            },
            "application":
            {
                "id": "e395cd36-9b1f-4f51-bec0-d4e940cd0739",
                "name": "ICA"
            }
    }
    def post_custom_event(metric_name: str, metric_value: str, threshold: str, sample_name: str):
        api_url = f"{ICA_HOST}/api/projects/{PROJECT_ID}/customEvents"
        headers = {
            "Content-Type": "application/vnd.illumina.v3+json",
            "accept": "application/vnd.illumina.v3+json",
            "X-API-Key": f"{ICA_API_KEY}"
        }
        content = {\"code\": \"ICA_CUSTOM_123\", \"content\": { \"metric_name\": metric_name, \"metric_value\": metric_value,\"threshold\": threshold, \"sample_name\": sample_name}}
        json_data = json.dumps(content)
        response = requests.post(api_url, data=json_data, headers=headers)
    
        if response.status_code != 204:
            print(f"[EVENT-ERROR] Could not post metric failure event for the metric {metric_name} (sample {sample_name}).")
                    

    Bench Internal Command Line Interface

    The following is a list of available bench CLI commands and their options. You can execute these from within a running bench workspace.

    Please refer to the examples from the Illumina website for more details.

    workspace-ctl

    workspace-ctl completion

    workspace-ctl compute

    workspace-ctl compute get-cluster-details

    workspace-ctl compute get-logs

    workspace-ctl compute get-pools

    workspace-ctl compute scale-pool

    workspace-ctl data

    workspace-ctl data create-mount

    workspace-ctl data delete-mount

    workspace-ctl data get-mounts

    workspace-ctl help

    workspace-ctl help completion

    workspace-ctl help compute

    workspace-ctl help compute get-cluster-details

    workspace-ctl help compute get-logs

    workspace-ctl help compute get-pools

    workspace-ctl help compute scale-pool

    workspace-ctl help data

    workspace-ctl help data create-mount

    workspace-ctl help data delete-mount

    workspace-ctl help data get-mounts

    workspace-ctl help help

    workspace-ctl help software

    workspace-ctl help software get-server-metadata

    workspace-ctl help software get-software-settings

    workspace-ctl help workspace

    workspace-ctl help workspace get-cluster-settings

    workspace-ctl help workspace get-connection-details

    workspace-ctl help workspace get-workspace-settings

    workspace-ctl software

    workspace-ctl software get-server-metadata

    workspace-ctl software get-software-settings

    workspace-ctl workspace

    workspace-ctl workspace get-cluster-settings

    workspace-ctl workspace get-connection-details

    workspace-ctl workspace get-workspace-settings

    Usage:
      workspace-ctl [flags]
      workspace-ctl [command]
    
    Available Commands:
      completion  Generate completion script
      compute     
      data        
      help        Help about any command
      software    
      workspace   
    
    Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
      -h, --help               help for workspace-ctl
          --help-tree          
          --help-verbose       
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    
    Use "workspace-ctl [command] --help" for more information about a command.
    To load completions:
    
    Bash:
    
      $ source <(workspace-ctl completion bash)
    
      # To load completions for each session, execute once:
      # Linux:
      $ workspace-ctl completion bash > /etc/bash_completion.d/workspace-ctl
      # macOS:
      $ workspace-ctl completion bash > /usr/local/etc/bash_completion.d/workspace-ctl
    
    Zsh:
    
      # If shell completion is not already enabled in your environment,
      # you will need to enable it.  You can execute the following once:
    
      $ echo "autoload -U compinit; compinit" >> ~/.zshrc
    
      # To load completions for each session, execute once:
      $ yourprogram completion zsh > "${fpath[1]}/_yourprogram"
    
      # You will need to start a new shell for this setup to take effect.
    
    fish:
    
      $ workspace-ctl completion fish | source
    
      # To load completions for each session, execute once:
      $ workspace-ctl completion fish > ~/.config/fish/completions/workspace-ctl.fish
    
    PowerShell:
    
      PS> workspace-ctl completion powershell | Out-String | Invoke-Expression
      # To load completions for every new session, run:
      PS> workspace-ctl completion powershell > workspace-ctl.ps1
      # and source this file from your PowerShell profile.
    
    Usage:
      workspace-ctl completion [bash|zsh|fish|powershell]
    
    Global Options:
          --debug          output debug logs
          --dry-run        do not send the request to server
          --help-tree      Display commands as a tree
          --help-verbose   Extended help topics and options
          --print-curl     print curl equivalent do not send the request to server
    Usage:
      workspace-ctl compute [flags]
      workspace-ctl compute [command]
    
    Available Commands:
      get-cluster-details 
      get-logs            
      get-pools           
      scale-pool          
    
    Flags:
      -h, --help           help for compute
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    
    Use "workspace-ctl compute [command] --help" for more information about a command.
    Usage:
      workspace-ctl compute get-cluster-details [flags]
    
    Flags:
      -h, --help           help for get-cluster-details
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl compute get-logs [flags]
    
    Flags:
      -h, --help           help for get-logs
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl compute get-pools [flags]
    
    Flags:
          --cluster-id string   Required. Cluster ID
      -h, --help                help for get-pools
          --help-tree           
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl compute scale-pool [flags]
    
    Flags:
          --cluster-id string       Required. Cluster ID
      -h, --help                    help for scale-pool
          --help-tree               
          --help-verbose            
          --pool-id string          Required. Pool ID
          --pool-member-count int   Required. New pool size
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl data [flags]
      workspace-ctl data [command]
    
    Available Commands:
      create-mount Create a data mount under /data/mounts. Return newly created mount.
      delete-mount Delete a data mount
      get-mounts   Returns the list of data mounts
    
    Flags:
      -h, --help           help for data
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    
    Use "workspace-ctl data [command] --help" for more information about a command.
    Create a data mount under /data/mounts. Return newly created mount.
    
    Usage:
      workspace-ctl data create-mount [flags]
    
    Aliases:
      create-mount, mount
    
    Flags:
      -h, --help                help for create-mount
          --help-tree           Display commands as a tree
          --help-verbose        Extended help topics and options
          --mode string         Enum:["read-only","read-write"]. Mount mode i.e. read-only, read-write
          --mount-path string   Where to mount the data, e.g. /data/mounts/hg38data (or simply hg38data)
          --source string       Required. Source data location, e.g. /data/project/myData/hg38 or fol.bc53010dec124817f6fd08da4cf3c48a (ICA folder id)
          --wait                Wait for new mount to be available on all nodes before sending response
          --wait-timeout int    Max number of seconds for wait option. Absolute max: 300 (default 300)
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Delete a data mount
    
    Usage:
      workspace-ctl data delete-mount [flags]
    
    Aliases:
      delete-mount, unmount
    
    Flags:
      -h, --help                help for delete-mount
          --help-tree           
          --help-verbose        
          --id string           Id of mount to remove
          --mount-path string   Path of mount to remove
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Returns the list of data mounts
    
    Usage:
      workspace-ctl data get-mounts [flags]
    
    Aliases:
      get-mounts, list-mounts
    
    Flags:
      -h, --help           help for get-mounts
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl [flags]
      workspace-ctl [command]
    
    Available Commands:
      completion  Generate completion script
      compute     
      data        
      help        Help about any command
      software    
      workspace   
    
    Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
      -h, --help               help for workspace-ctl
          --help-tree          
          --help-verbose       
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    
    Use "workspace-ctl [command] --help" for more information about a command.
    To load completions:
    
    Bash:
    
      $ source <(yourprogram completion bash)
    
      # To load completions for each session, execute once:
      # Linux:
      $ yourprogram completion bash > /etc/bash_completion.d/yourprogram
      # macOS:
      $ yourprogram completion bash > /usr/local/etc/bash_completion.d/yourprogram
    
    Zsh:
    
      # If shell completion is not already enabled in your environment,
      # you will need to enable it.  You can execute the following once:
    
      $ echo "autoload -U compinit; compinit" >> ~/.zshrc
    
      # To load completions for each session, execute once:
      $ yourprogram completion zsh > "${fpath[1]}/_yourprogram"
    
      # You will need to start a new shell for this setup to take effect.
    
    fish:
    
      $ yourprogram completion fish | source
    
      # To load completions for each session, execute once:
      $ yourprogram completion fish > ~/.config/fish/completions/yourprogram.fish
    
    PowerShell:
    
      PS> yourprogram completion powershell | Out-String | Invoke-Expression
    
      # To load completions for every new session, run:
      PS> yourprogram completion powershell > yourprogram.ps1
      # and source this file from your PowerShell profile.
    
    Usage:
      workspace-ctl completion [bash|zsh|fish|powershell]
    
    Flags:
      -h, --help   help for completion
    Usage:
      workspace-ctl compute [flags]
      workspace-ctl compute [command]
    
    Available Commands:
      get-cluster-details 
      get-logs            
      get-pools           
      scale-pool          
    
    Flags:
      -h, --help           help for compute
          --help-tree      
          --help-verbose
    
    Use "workspace-ctl compute [command] --help" for more information about a command.
    Usage:
      workspace-ctl compute get-cluster-details [flags]
    
    Flags:
      -h, --help           help for get-cluster-details
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl compute get-logs [flags]
    
    Flags:
      -h, --help           help for get-logs
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl compute get-pools [flags]
    
    Flags:
          --cluster-id string   Required. Cluster ID
      -h, --help                help for get-pools
          --help-tree           
          --help-verbose
    Usage:
      workspace-ctl compute scale-pool [flags]
    
    Flags:
          --cluster-id string       Required. Cluster ID
      -h, --help                    help for scale-pool
          --help-tree               
          --help-verbose            
          --pool-id string          Required. Pool ID
          --pool-member-count int   Required. New pool size
    Usage:
      workspace-ctl data [flags]
      workspace-ctl data [command]
    
    Available Commands:
      create-mount Create a data mount under /data/mounts. Return newly created mount.
      delete-mount Delete a data mount
      get-mounts   Returns the list of data mounts
    
    Flags:
      -h, --help           help for data
          --help-tree      
          --help-verbose
    
    Use "workspace-ctl data [command] --help" for more information about a command.
    Create a data mount under /data/mounts. Return newly created mount.
    
    Usage:
      workspace-ctl data create-mount [flags]
    
    Aliases:
      create-mount, mount
    
    Flags:
      -h, --help                help for create-mount
          --help-tree           
          --help-verbose        
          --mount-path string   Where to mount the data, e.g. /data/mounts/hg38data (or simply hg38data)
          --source string       Required. Source data location, e.g. /data/project/myData/hg38 or fol.bc53010dec124817f6fd08da4cf3c48a (ICA folder id)
          --wait                Wait for new mount to be available on all nodes before sending response
          --wait-timeout int    Max number of seconds for wait option. Absolute max: 300 (default 300)
    Delete a data mount
    
    Usage:
      workspace-ctl data delete-mount [flags]
    
    Aliases:
      delete-mount, unmount
    
    Flags:
      -h, --help                help for delete-mount
          --help-tree           
          --help-verbose        
          --id string           Id of mount to remove
          --mount-path string   Path of mount to remove
    Returns the list of data mounts
    
    Usage:
      workspace-ctl data get-mounts [flags]
    
    Aliases:
      get-mounts, list-mounts
    
    Flags:
      -h, --help           help for get-mounts
          --help-tree      
          --help-verbose
    Help provides help for any command in the application.
    Simply type workspace-ctl help [path to command] for full details.
    
    Usage:
      workspace-ctl help [command] [flags]
    
    Flags:
      -h, --help   help for help
    Usage:
      workspace-ctl software [flags]
      workspace-ctl software [command]
    
    Available Commands:
      get-server-metadata   
      get-software-settings 
    
    Flags:
      -h, --help           help for software
          --help-tree      
          --help-verbose
    
    Use "workspace-ctl software [command] --help" for more information about a command.
    Usage:
      workspace-ctl software get-server-metadata [flags]
    
    Flags:
      -h, --help           help for get-server-metadata
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl software get-software-settings [flags]
    
    Flags:
      -h, --help           help for get-software-settings
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl workspace [flags]
      workspace-ctl workspace [command]
    
    Available Commands:
      get-cluster-settings   
      get-connection-details 
      get-workspace-settings 
    
    Flags:
      -h, --help           help for workspace
          --help-tree      
          --help-verbose
    
    Use "workspace-ctl workspace [command] --help" for more information about a command.
    Usage:
      workspace-ctl workspace get-cluster-settings [flags]
    
    Flags:
      -h, --help           help for get-cluster-settings
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl workspace get-connection-details [flags]
    
    Flags:
      -h, --help           help for get-connection-details
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl workspace get-workspace-settings [flags]
    
    Flags:
      -h, --help           help for get-workspace-settings
          --help-tree      
          --help-verbose
    Usage:
      workspace-ctl software [flags]
      workspace-ctl software [command]
    
    Available Commands:
      get-server-metadata   
      get-software-settings 
    
    Flags:
      -h, --help           help for software
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    
    Use "workspace-ctl software [command] --help" for more information about a command.
    Usage:
      workspace-ctl software get-server-metadata [flags]
    
    Flags:
      -h, --help           help for get-server-metadata
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl software get-software-settings [flags]
    
    Flags:
      -h, --help           help for get-software-settings
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl workspace [flags]
      workspace-ctl workspace [command]
    
    Available Commands:
      get-cluster-settings   
      get-connection-details 
      get-workspace-settings 
    
    Flags:
      -h, --help           help for workspace
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    
    Use "workspace-ctl workspace [command] --help" for more information about a command.
    Usage:
      workspace-ctl workspace get-cluster-settings [flags]
    
    Flags:
      -h, --help           help for get-cluster-settings
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl workspace get-connection-details [flags]
    
    Flags:
      -h, --help           help for get-connection-details
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")
    Usage:
      workspace-ctl workspace get-workspace-settings [flags]
    
    Flags:
      -h, --help           help for get-workspace-settings
          --help-tree      
          --help-verbose
    
    Global Flags:
          --X-API-Key string   
          --base-path string   For example: / (default "/")
          --config string      config file path
          --debug              output debug logs
          --dry-run            do not send the request to server
          --hostname string    hostname of the service (default "api:8080")
          --print-curl         print curl equivalent do not send the request to server
          --scheme string      Choose from: [http] (default "http")

    Pipelines

    A Pipeline is a series of Tools with connected inputs and outputs configured to execute in a specific order.

    Linking Existing Pipelines

    Linking a pipeline (Projects > your_project > Flow > Pipelines > Link) adds that pipeline to your project. This is not as a copy, but as the actual pipeline, so any changes to the pipeline are atomatically propagated to and from any project which has this pipeline linked.

    You can link a pipeline if it is not already linked to your project and it is from your tenant or available in your bundle or activation code.

    Activation codes are tokens which allow you to run your analyses and are used for accounting and allocating the appropriate resources. Platform Core will automatically determine the best matching activation code, but this can be overwritten if needed.

    If you unlink a pipeline it removes the pipeline from your project, but it remains part of the list of pipelines of your tenant, so it can be linked to other projects later on.

    There is no way to permanently delete a pipeline.


    Create a Pipeline

    Pipelines are created and stored within projects.

    1. Navigate to Projects > your_project > Flow > Pipelines > +Create.

    2. Select Nextflow (XML / JSON / Git) , CWL Graphical or CWL code (XML / JSON / Git) to create a new Pipeline.

    3. Configure pipeline settings in the pipeline property tabs.

    4. When creating a graphical CWL pipeline, drag connectors to link tools to input and output files in the canvas. Required tool inputs are indicated by a yellow connector.

    5. Select Save.

    For pipeline authors sharing and distributing their pipelines, the draft, released, deprecated, and archived statuses provide a structured framework for managing pipeline availability, user communication, and transition planning. To change the pipeline status, select it at Projects > your_project > Pipelines > your_pipeline > change status.


    The following sections describe the properties that can be configured in each tab of the pipeline editor.

    Depending on how you design the pipeline, the displayed tabs differ between the graphical and code definitions. For CWL you have a choice on how to define the pipeline, Nextflow is always defined in code mode.

    Any additional source files related to your pipeline will be displayed here in alphabetical order.

    See the following pages for language-specific details for defining pipelines:


    The details tab provides options for configuring basic information about the pipeline.

    Field
    Entry

    The following information becomes visible when viewing the pipeline details.

    Field
    Entry

    The clone action will be shown in the pipeline details at the top-right. Cloning a pipeline allows you to create modifications without impacting the original pipeline. When cloning a pipeline, you become the owner of the cloned pipeline. When you clone a pipeline, you must give it a unique name because no duplicate names are allowed within all projects of the tenant. So the name must be unique per tenant. It is possible that you see the same pipeline name twice when a pipeline linked from another tenant is cloned with that same name in your tenant. The name is then still unique per tenant, but you will see them both in your tenant.

    When you clone a Nextflow pipeline, a verification of the configured Nextflow version is done to prevent the use of deprecated versions.

    The Documentation tab provides is the place where you explain how your pipeline works to users. The description appears in the tool repository but is excluded from exported CWL definitions. If no documentation has been provided, this tab will be empty.

    When using graphical mode for the pipeline definition, the Definition tab provides options for configuring the pipeline using a visualization panel and a list of component menus.

    Menu
    Description

    This page is used to specify all relevant information about the pipeline parameters.

    For each process defined by the workflow, Platform Core will launch a compute node to execute the process.

    • For each compute type, the standard (default - AWS on-demand) or economy (AWS spot instance) tiers can be selected.

    • When selecting an fpga instance type for running analyses on Platform Core, it is recommended to use the medium size. While the large size offers slight performance benefits, these do not proportionately justify the associated cost increase for most use cases.

    • When no type is specified, the default type of compute node is

    By default, compute nodes have no scratch space. This is an advanced setting and should only be used when absolutely necessary as it will incur additional costs and may offer only limited performance benefits because it is not local to the compute node.

    For simplicity and better integration, consider using shared storage available at /ces. It is what is provided in the Small/Medium/Large+ compute types. This shared storage is used when writing files with relative paths.

    Daemon sets and system processes consume approximately 1 CPU and 2 GB Memory from the base values shown in the table. Consumption will vary based on the activity of the pod.

    Syntax highlighting is determined by the file type, but you can select alternative syntax highlighting with the drop-down selection list. The following formats are supported:

    • DIFF (.diff)

    • GROOVY (.groovy .nf)

    • JAVASCRIPT (.js .javascript)

    • JSON (.json)

    The Nextflow project main script.

    The Nextflow configuration settings.

    The Common Workflow Language main script.

    Multiple files can be added by selecting the +Create option at the bottom of the screen to make pipelines more modular and manageable.

    See

    Here patterns for detecting report files in the analysis output can be defined. On opening an analysis result window of this pipeline, an additional tab will display these report files. The goal is to provide a pipeline-specific user-friendly representation of the analysis result.

    To add a report select the + symbol on the left side. Provide your report with a unique name, a regular expression matching the report and optionally, select the format of the report. This must be the source format of the report data generated during the analysis.


    Use the following instructions to start a new analysis for a single pipeline.

    1. Select Projects > your_project > Flow > Pipelines.

    2. Select the pipeline or pipeline details of the pipeline you want to run.

    3. Select Start Analysis.

    The Start Analysis screen provides the configuration options for the analysis.

    Field
    Entry

    1 When using the API, you can to be outside of the current project.

    You can abort a running analysis from either the analysis overview (Projects > your_project > Flow > Analyses > your_analysis > Manage > Abort) or from the analysis details (Projects > your_project > Flow > Analyses > your_analysis > Details tab > Abort).

    You can view analysis results on the Analyses page or in the output folder on the Data page. You can also rerun your analysis from here.

    1. Select a project, and then select the Projects > your_project > Flow > Analyses page.

    2. Select the desired analysis.

    3. From the output files tab, expand the list if needed and select an output file.

    To see more details of your analyses, return to Projects > your_project > Flow > Analyses > your_analysis. The following tabs will be visible (depending on pipeline):

    • Details - View information on the pipeline configuration.

    • Output files - View the output of the Analysis.

    • Steps - stderr and stdout information.

    Status

    The of the pipeline.

    Proprietary

    Hide the pipeline scripts and details from users who do not belong to the tenant who owns the pipeline. This also prevents cloning the pipeline.

    Storage size

    User selectable for running the pipeline. This must be large enough to run the pipeline, but setting it too large incurs unnecessary costs.

    Links

    External reference links. (max 100 chars as name and 2048 chars as link)

    Input files

    Descriptions of input files used in the pipeline.

    Output files

    Descriptions of output files used in the pipeline.

    Tool

    Details about the tool selected in the visualization panel.

    Tool repository

    A list of tools available to be used in the pipeline.

    standard-small
    .

    standard-medium

    4

    16

    standard-medium

    standard, medium

    standard-large

    8

    32

    standard-large

    standard, large

    standard-xlarge

    16

    64

    standard-xlarge

    standard, xlarge

    standard-2xlarge

    32

    128

    standard-2xlarge

    standard, 2xlarge

    standard-3xlarge

    64

    256

    standard-3xlarge

    standard, 3xlarge

    hicpu-small

    16

    32

    hicpu-small

    hicpu, small

    hicpu-medium

    36

    72

    hicpu-medium

    hicpu, medium

    hicpu-large

    72

    144

    hicpu-large

    hicpu, large

    himem-small

    8

    64

    himem-small

    himem, small

    himem-medium

    16

    128

    himem-medium

    himem, medium

    himem-large

    48

    384

    himem-large

    himem, large

    himem-xlarge2

    92

    700

    himem-xlarge

    himem, xlarge

    hiio-small

    2

    16

    hiio-small

    hiio, small

    hiio-medium

    4

    32

    hiio-medium

    hiio, medium

    fpga2-medium1

    24

    256

    fpga2-medium

    fpga2,medium

    fpga2-large1

    48

    512

    fpga2-large

    fpga2,large

    gpu-small

    8

    61

    gpu-small

    gpu, small

    gpu-medium

    32

    244

    gpu-medium

    gpu, medium

    transfer-small3

    4

    10

    transfer-small

    transfer, small

    transfer-medium 3

    8

    15

    transfer-medium

    transfer, medium

    transfer-large3

    16

    30

    transfer-large

    transfer, large

    SH (.sh)

  • SQL (.sql)

  • TXT (.txt)

  • XML (.xml)

  • YAML (.yaml .cwl)

  • Configure
    . (see below)
  • Select Start Analysis.

  • View the analysis status on the Analyses page.

    • Requested—The analysis is scheduled to begin.

    • In Progress—The analysis is in progress.

    • Succeeded—The analysis is complete.

    • Failed —The analysis has failed.

    • Aborted — The analysis was aborted before completing.

  • To end an analysis, select Abort.

  • To perform a completed analysis again, select Re-run.

  • Notification (optional)

    Enter your email address if you want to be notified when the analysis completes.

    Output Folder1

    Select a folder in which the output folder of the analysis should be located. When no folder is selected, the output folder will be located in the root of the project. When you open the folder selection dialog, you have the option to create a new folder (bottom of the screen). You can create nested folders by using the folder/subfolder syntax. Do not use a / before the first folder or after the last subfolder in the folder creation dialog.

    Logs Folder

    Select a folder where the analysis logs will be stored. When no logs folder is selected, they will be stored as subfolder in the output folder. When you select a logs folder different from your output folder, the folders will be separated. When you open the folder selection dialog, you can create a new folder (bottom of the screen). Create nested folders by using the folder/subfolder syntax. Do not use a / before the first folder or after the last subfolder in the folder creation dialog.

    When choosing a folder containing data, files with the same name will be overwritten.

    Input

    Select the input files to use in the analysis. (max. 50,000)

    Settings (optional)

    Provide input settings.

    Resources

    Select the storage size for your analysis. The available storage sizes depend on your selected Pricing subscription. See for more information.

    If you want to add or remove any user or technical tags, you can do so from the data details view.
  • If you want to download the file, select Download.

  • To see the data in the data view where you can easily navigate between files, select Open in data.

  • To preview the file, select the View tab.

  • CWL - The CWL pipeline definition.
  • Nextflow timeline - Nextflow process execution timeline.

  • Nextflow execution - Nextflow analysis report. Showing the run times, commands, resource usage and tasks for Nextflow analyses.

  • Report - Shows the reports defined on the pipeline report tab.

  • Code (pipeline name)

    The name of the pipeline. The name must be unique within the tenant, including linked and unlinked pipelines.

    Nextflow Version

    User selectable Nextflow version available only for Nextflow pipelines

    Description

    A short description of the pipeline.

    ID

    Unique Identifier of the pipeline.

    URN

    Identification of the pipeline in Uniform Resource Name

    Machine profiles

    Compute types available to use with Tools in the pipeline.

    Shared settings

    Settings for pipelines used in more than one tool.

    Reference files

    Descriptions of reference files used in the pipeline.

    Compute Type

    CPUs

    Mem (GiB)

    Nextflow (pod.value)

    CWL (type, size)

    standard-small

    2

    8

    standard-small

    User Reference

    The unique analysis name.

    Pipeline

    This is not editable, but provides a link to the pipeline so you want to look up details of the pipeline.

    User tags (optional)

    One or more tags used to filter the analysis list. Select from existing tags or type a new tag name in the field.

    Pipelines use the latest tool definition when the pipeline was last saved. Tool changes do not automatically propagate to the pipeline. In order to update the pipeline with the latest tool changes, edit the pipeline definition by removing the tool and re-adding it back to the pipeline.

    Individual Pipeline files are limited to 20 Megabytes. If you need to add more than this, split your content over multiple files.

    Pipeline Statuses

    You can edit pipelines while they are in Draft status. Once they move away from draft, pipelines can no longer be edited. Pipelines can be cloned (top right in the details view) to create a new editable version.

    Pipeline Properties

    Details

    Documentation

    Definition (Graphical)

    In graphical mode, you can drag and drop inputs into the visualization panel to connect them to the tools. Make sure to connect the input icons to the tool before editing the input details in the component menu. Required tool inputs are indicated by a yellow connector.

    Safari is not supported as browser for graphical editing.

    When creating a graphical CWL pipeline, do not use spaces in the input field names, use underscores instead. The API performs normalization of input names when running the analysis to prevent issues with special characters (such as accented letters) by replacing them with their more common (unaccented) counterpart. Part of this normalization includes replacing spaces in names with underscores. This normalization is applied to file input name, reference file input name, step id and step parameters.

    You will encounter the error ICA_API_004 "No value found for required input parameter" when trying to run an API analysis on a graphical pipeline that has been designed with spaces in input parameters.

    XML Configuration / JSON Inputform Files (Code)

    There is a limit of 200 reports per report pattern which will be shown when you have multiple reports matching your regular expression.

    Compute Resources

    Compute Nodes

    You can see which resources were used in the different analysis steps at Projects > your_project > Flow > Analyses > your_analysis > Steps tab. (For child steps, these are displayed on the parent step)

    Scratch space notes

    If you do require scratch space via a Nextflow pod annotation or a CWL resource requirement, the path is /scratch.

    • For Nextflow pod annotation: 'volumes.illumina.com/scratchSize', value: '1TiB' will reserve 1 TiB.

    • For CWL, adding - class: ResourceRequirement tmpdirMin: 5000 to your requirements section will reserve 5000 MiB for CWL.

    Avoid the following as it does not align with ICAv2 scratch space configuration.

    • Container overlay tmp path: /tmp

    • Legacy paths: /ephemeral

    • Environment Variables ($TMPDIR, $TEMP and $TMP)

    Compute Types

    1 DRAGEN pipelines running on fpga2 compute type will incur a DRAGEN license cost of 0.10 BIC per gigabase of data processed, with additional discounts as shown below.

    • 80 or less gigabase per sample - no discount - 0.10 BIC per gigabase

    • > 80 to 160 gigabase per sample - 20% discount - 0.08 BIC per gigabase

    • > 160 to 240 gigabase per sample - 30% discount - 0.07 BIC per gigabase

    • > 240 to 320 gigabase per sample - 40% discount - 0.06 BIC per gigabase

    • > 320 and more gigabase per sample - 50% discount - 0.05 BIC per gigabase

    DRAGEN Iterative gVCF Genotyper (iGG) will incur a license cost of 0.6216 BIC per gigabase. For example, a sample of 3.3 gigabase human reference will result in 2 BIC per sample. The associated Compute costs will be based on the compute instance chosen.

    The ORA (Original Read Archive) compression pipeline is part of the DRAGEN platform. It performs lossless genomic data compression to reduce the size of FASTQ and FASTQ.GZ files (up to 4-6x smaller) while preserving data integrity with internal checksum verification. The ORA compression pipeline has a license cost of 0.017 BIC per input Gbase; decompression does not have an associated license cost.

    The DRAGEN_Map_Align pipeline running on fpga2 has the standard DRAGEN license cost of 0.10 BIC per Gbase processed, with but replaces the standard volume discounts with the discounts shown below.

    • 10 or less gigabase per sample - no discount - 0.10 BIC per gigabase

    • > 10 to 25 gigabase per sample - 30% discount - 0.07 BIC per gigabase

    • > 25 to 60 gigabase per sample - 70% discount - 0.03 BIC per gigabase

    • > 60 and more gigabase per sample - 85% discount - 0.015 BIC per gigabase

    (2) The compute type himem-xlarge has low availability.

    FPGA1 instances were decommissioned on Nov 1st 2025. Please migrate to F2 for improved capacity and performance with up to 40% reduced turnaround time for analysis.

    (3) The transfer size selected is based on the selected storage size for compute type and used during upload and download system tasks.

    Nextflow/CWL Files (Code)

    If the file type is not recognized, it will default to text display. This can result in the application interpreting binary files as text when trying to display the contents.

    Main.nf (Nextflow code)

    Nextflow.config (Nextflow code)

    Workflow.cwl (CWL code)

    Adding Files

    Metadata Model

    Report

    There is a limit of 20 reports per report pattern which will be shown when you have multiple reports matching your regular expression.

    Start a New Analysis

    Analysis Settings

    Aborting Analyses

    View Analysis Results

    Other tabs can be available depending on your chosen pipeline.

    Status

    Draft

    Purpose

    Use the draft status while developing or testing a pipeline version internally.

    Best Practice

    Only share draft pipelines with collaborators who are actively involved in development.

    Status

    Released

    Purpose

    The released status signals that a pipeline is stable and ready for general use.

    Best Practice

    Share your pipeline when it is ready for broad use. Ensure users have access to current documentation and know where to find support or updates. Releasing a pipeline is only possible if all tools of that pipeline must be in released status.

    Status

    Deprecated

    Purpose

    Deprecation is used when a pipeline version is scheduled for retirement or replacement. Deprecated pipelines can not be linked to bundles, but will not be unlinked from existing bundles. Users who already have access will still be able to start analyses. You can add a message (max 256 chars) when deprecating pipelines.

    Best Practice

    Deprecate in advance of archiving a pipeline, making sure the new pipeline is available in the same bundle as the deprecated pipeline. This will allow the pipeline author to link the new or alternative pipeline in the deprecation message field.

    Status

    Archived

    Purpose

    Archiving a pipeline version removes it from active use; users can no longer launch analyses. Archived pipelines can not be linked to bundles, but are not automatically unlinked from bundles or projects. You can add a message (max 256 chars) when archiving pipelines.

    Best Practice

    Warn users in advance: Deprecate the pipeline before archiving to allow existing users time to transition. Use the archive message to point users to the new or alternative pipeline

    CWL Graphical

    • Details

    • Documentation

    • Definition

    • Analysis Report

    CWL Code

    • Details

    • Documentation

    • Inputform files (JSON) or XML Configuration (XML)

    • CWL Files

    Nextflow Code

    • Details

    • Documentation

    • Inputform Files (JSON) or XML Configuration (XML)

    • Nextflow files

    Nextflow
    CWL
    Metadata Models
    redirect analysis outputs

    standard, small

    analysis settings

    Data

    The Data inventory provides access to the files and folders stored in the project or linked to the project. Here, you can perform searches and data management operations such as moving, copying, deleting and (un)archiving.

    See also which are a special form of data storage optimised for fast processing.

    Recommended Practices

    File/Folder Naming

    Platform Core supports UTF-8 characters in file and folder names for data. Please follow the guidelines detailed below. (For more information about recommended approaches to file naming that can be applicable across platforms, please refer to the AWS S3 documentation.)

    Folders and files cannot be renamed after they have been created. To rename a folder, you will need to create a new folder with the desired name, move the contents from the original folder into the new one, and then delete the original folder. Please see the section for more information.

    Characters generally considered "safe"
    • Alphanumeric characters

      • 0-9

    Data Formats

    See the list of supported Data Formats

    Data Privacy

    When adding data to Platform Core, prioritize data privacy. Whether you're using storage configurations like AWS S3 or performing Platform Core data uploads, careful management of data access needs to be considered. When setting up cloud storage, confirm that configuration settings prevent unauthorized access. Always verify that uploads are free of unintended data to avoid privacy breaches. For more detailed information, refer to the Platform Core Security and Compliance section.

    Data Integrity

    See Data Integrity


    Viewing Data

    On the Projects > your_project > Data page, you can view file information and preview files.

    You can switch between folder view and flat view with the icons at the left.

    • Folder view shows the navigation structure and only the files and folders in the current folder. Searches in folder view will be performed on the current folder and all subfolders of the current folder.

    • Flat view shows a list of all files and folders within the current project. When you perform searches in flat view, all data of your project will be considered.

    Tree view shows the navigation structure and only the files and folders in the current folder. Searches in tree view will be performed on the current folder and all subfolders of the current folder.

    List view shows all files and folders within the current project. When you perform searches in list view, all data of your project will be considered.

    To view file details click on the filename to see the file details.

    • Run input tags identifies the last 100 pipelines which used this file as input.

    • Run output tags identifies the pipeline which created the file.

    • Connector tags show if the file was added via browser upload or connector.

    To view file contents, select the checkbox at the beginning of the line and then select View from the top menu. Alternatively, you can first click on the filename to see the details and then click the view tab to preview the file.

    If your data is the result of an analysis, you can find the analysis which created it at Projects > your_project > Data > your_data > view > Data details tab > Source analysis. Clicking the link here will open the analysis.

    To see the ongoing actions (copying and moving) on data in the data overview (Projects > your_project > Data), add the ongoing actions column from the column list if it is not present yet. You can also consult the data detail view for ongoing actions by clicking on the data in the overview. When clicking on an ongoing action itself, the data job details of the most recent created data job are shown.

    If you open a folder by clicking it, you can see the folder details link at the top right. This will open the details screen where you can consult the folder size and number of files in that folder, the owning project, ongoing actions and folder id. You can also download the folder and all contents here with the download button.

    To help navigate between folders in flat view, you can use the "path' column in the data view which will open the folder containing the selected file in tree view. If you want to go further up the folder path, you can use the folder structure above the file view. If the path is not visible, you can add it with the three-columns symbol next to the filter symbol.

    To quickly find data, use the search dialog at the top right. Search is performed with automatic wildcards before and after the search text. You can use * as additional wildcard, for example b*n will match bunny as it is interpreted as *b*n*.

    You can search on the file name, the path (/folder/subfolder) and tags.

    When Secondary Data is added to a data record, those secondary data records are mounted in the same parent folder path as the primary data file when the primary data file is provided as an input to a pipeline. Secondary data is intended to work with the CWL feature. This is commonly used with genomic data such as BAM files with companion BAM index files.


    You can create hyperlinks to data to quickly share it with the following syntax:

    Variable
    Location

    You can export the list of data which you see in the overview as a CSV, JSON, or excel file.

    1. Select one or more files to export at Projects > your_project > Data.

    2. Select Export at the bottom of the screen.

    3. Choose between the following export options:


    Single files can be downloaded directly from within the UI.

    • Select the checkbox next to the file which you want to download, followed by Download > Browser Download > Download.

    • You can also download files from their details screen. Click on the file name and select Download at the bottom of the screen. Depending on the size of your file, it may take some time to load the file contents.

    You can trigger an asynchronous download via service connector using the Schedule for Download button with one or more files selected.

    1. Select a file or files to download.

    2. Select Download > Schedule download (for files or folders). This will display a list of all available connectors.

    3. Select a connector and optionally, enter your email address if you want to be notified of download completion, and then select Download.

    You can view the progress of the download or abort the scheduled download on the page for the project.

    Uploading data to the platform makes it available to analysis workflows and tools.

    To upload data manually via the drag-and-drop interface in the platform UI, go to Projects > your_project > Data and either

    • Drag a file from your system into the Choose a file or drag it here box.

    • Select the Choose a file or drag it here box, and then choose a file. Select Open to upload the file.

    Your files are added to the Data page with status partial during upload and become available when upload completes.

    For instructions on uploading/downloading data via CLI, see .


    You can copy data from your project to a different folder within the same project or you can copy data from another project to your current project, provided you have the necessary access rights.

    You can copy data from a subfolder to a higher-level folder to move data up one or more levels (folder/destination/source). You can not copy data from the source folder onto itself or onto a subfolder of the source folder as this would result in a loop.

    The person copying the data must have the following rights:

    Copy Data Rights
    Source Project
    Destination Project

    The following restrictions apply when copying data:

    Copy Data Restrictions
    Source Project
    Destination Project
    1. Go to the destination project for your data copy and proceed to Projects > your_project > Data > Manage > Copy From.

    2. Optionally, use the filters or search with the search box for the desired data.

    3. Select the data (individual files or folders with data) you want to copy.

    • INITIALIZED

    • WAITING_FOR_RESOURCES

    • RUNNING

    • STOPPED - When choosing to stop the batch job.

    To see the ongoing actions on data in the data overview (Projects > your_project > Data), you can add the ongoing actions column from the column list with the three column symbol at the top right, next to the filter funnel. You can also consult the data detail view for ongoing actions by clicking on the data in the overview.


    You can move data within a project or between different projects to which you have access. If your browser allows notifications, a pop-up will appear when the move is completed.

    • Move From is used when you are in the destination location.

    • Move To is used when you are in the source location.

    Before moving the data, pre-checks are performed to verify that the data can be moved and no currently running operations are being performed on the folder. Conflicting jobs and missing permissions will be reported.

    Once the move has started, no other operation must be performed on the data being moved to avoid potential data loss or duplication. When modifying data at the source or destination during a move process, incomplete data transfers may occur with duplicate folders and files with different identifiers.. You can manually transfer any remaining data and delete duplicate files and folders afterward.

    There are a number of rights and restrictions related to data move as this will delete the data in the source location.

    Move Data Rights
    Source Project
    Destination Project
    Move Data Restrictions
    Source Project
    Destination Project
    • 1000 Maximum Items: Up to 1000 items per move. Items include files and folders. Folders with subfolders and subfiles still count as one item.

    • Naming Conflicts: Cannot move to a destination with existing files/folders of the same name.

    • Linked Data Restrictions: Cannot move linked data move data to linked data.

    Move Data From is used when you are in the destination location.

    1. Navigate to Projects > your_project > Data > your_destination_location > Manage > Move From.

    2. Select the files and folders which you want to move.

    3. Select the Move button.

    Move Data To is used when you are in the source location. You will need to select the data you want to move from to current location and the destination to move it to.

    1. Navigate to Projects > your_project > Data > your_source_location.

    2. Select the files and folders which you want to move.

    3. Select to Projects > your_project > Data > your_source_location > Manage > Move To.

    • INITIALIZED

    • WAITING_FOR_RESOURCES

    • RUNNING

    • STOPPED - When choosing to stop the batch job.

    To see the ongoing actions on data in the data overview (Projects > your_project > Data), add the ongoing actions column from the column list with the three column symbol at the top right, next to the filter funnel. You can also consult the data detail view for ongoing actions by clicking on the data in the overview.


    To manually archive or delete files:

    1. Select the checkbox next to the file or files to delete or archive.

    2. Select Manage, and then select one of the following options:

      • Archive — Move the file or files to long-term storage (event code ICA_DATA_110).

    When attempting concurrent archiving or unarchiving of the same file, a message will inform you to wait for the currently running (un)archiving to finish first.

    To archive or delete files programmatically, you can use Platform Core's API endpoints:

    1. the file's information.

    2. Modify the dates of the file to be deleted/archived.

    3. the updated information back in Platform Core.


    Data linking creates a dynamic read-only view to the source data. You can use data linking to get access to data without running the risk of modifying the source material and to share data between projects. Linking ensures changes to the source data are immediately visible and no additional storage is required. You can recognise linked data by the green color and see the owning project as part of the details.

    Since this is read-only access, you cannot perform actions such as deleting, adding, moving or (un)archiving on linked data as these actions require write access.

    1. Select Projects > your_project > Data > Manage, and then select Link.

    2. To view data by project, select the funnel symbol, and then select Owning Project. If you know to which project the data is linked to, you can choose to filter on linked projects. If you click on a folder, the folder will open so you can access the files, if you click on a file, the file details will be opened.

    3. Select the checkbox next to the file or files to add.

    Your files will be added and visible in the Data page.

    If you link a folder instead of individual files, a warning is displayed indicating that, depending on the size of the folder, linking may take considerable time. The linking process will run in the background and the progress can be monitored on the Projects > your_project > activity > Batch Jobs screen. From here you can see more details such as how many files have already been linked, by clicking the batch job.

    To unlink the data, go to the root level of your project and select the linked folder or, if you have linked individual files separately, then you can select those linked files (limited to 100 at a time) and select Manage > Unlink. The progress can be monitored at Projects > your_project > Activity > Batch Jobs.

    Bash Command mktemp

  • CWL runtime.tmpdir

  • Metadata Model

  • Report

  • Metadata Model

  • Report

  • Metadata Model

  • Report

  • release status
    storage size
    Storage
    Clicking on a folder will open the folder itself, to see the folder details, use the folder details link at the top right of the screen.

    AnalysisID

    At YourProject > Flow > Analyses > YourAnalysis > ID

    To export only the list of selected files, select the Selected rows as the Rows to export option. To export the list of all files on the page, select Current page.
  • To export only the columns which are currently shown in your view, select Visible columns as the Columns to export option, otherwise, choose All columns.

  • Select the export format. (CSV/JSON/Excel)

  • Select any meta data which you want to keep with the copied data (user tags, technical system tags or instrument information).
  • Select which action to take if the data already exists (overwrite existing data, don't copy or keep both the original and the new copy by appending a version number to the copied data).

  • Select Copy to copy the data to your project. You can see the progress in Projects > your_project > Activity > Batch Jobs and if your browser permits it, a pop-up message will be displayed when the copy process completes.

  • SUCCEEDED - All files and folders are copied.

  • PARTIALLY_SUCCEEDED - Some files and folders could be copied, but not all. Partially succeeded will typically occur when files were being modified or unavailable while the copy process was running.

  • FAILED - None of the files and folders could be copied.

  • Self Move: Folders cannot be moved to themselves.
  • In-Transit Data: Cannot move data that is being moved.

  • Region Restrictions: No cross-region moves allowed.

  • Project Constraints: No moves from externally-managed projects or externally-managed data.

  • Status Requirement: Data must be in status available.

  • Ownership: Data must be owned by the user's tenant for cross-project moves.

  • Destination Default: If no target folder is selected, data moves to the root folder of the target project.

  • Select your target project and location. You can create a new folder to move data to by filling in the "New folder name (optional)" field. This does NOT rename an existing folder. To rename a folder, you will need to create a new folder with the desired name, move the contents from the original folder into the new one, and then delete the original folder.
  • Select the Move button.

  • SUCCEEDED - All files and folders are moved.

  • PARTIALLY_SUCCEEDED - Some files and folders could be moved, but not all. Partially succeeded will typically occur when files were being modified or unavailable while the move process was running.

  • FAILED - None of the files and folders could be moved.

  • Unarchive — Return the file or files from long-term storage. Unarchiving can take up to 48 hours, regardless of file size. Unarchived files can be used in analysis (event code ICA_DATA_114).
  • Delete — Remove the file completely (event code ICA_DATA_106).

  • Select Link.

    a-z
  • A-Z

  • Special characters

    • Exclamation point !

    • Hyphen -

    • Underscore _

    • Period .

    • Asterisk *

    • Single quote '

    • Open parenthesis (

    • Closed parenthesis )

  • https://<ServerURL>/ica/link/project/<ProjectID>/data/<FolderID>
    https://<ServerURL>/ica/link/project/<ProjectID>/analysis/<AnalysisID>

    ServerURL

    See browser address bar.

    projectID

    At YourProject > Details > URN > urn:ilmn:ica:project:ProjectID#MyProject

    FolderID

    At YourProject > Data > folder > folder details > ID

    Within a project

    • Contributor rights

    • Upload and Download rights

    • Contributor rights

    • Upload and Download rights

    Between different projects

    • Download rights

    • Viewer rights

    Within a project

    • No linked data

    • No partial data

    • No archived data

    • No Linked data

    Between different projects

    • Data sharing enabled

    • No partial data

    • No archived data

    • Within the same region

    Within a project

    • Contributor rights

    • Contributor rights

    Between different projects

    • Download rights

    • Contributor rights

    Within a project

    • No linked data

    • No partial data

    • No archived data

    • No Linked data

    Between different projects

    • Data sharing enabled

    • Data owned by user's tenant

    • No linked data

    • No partial data

    • No archived data

    • No externally managed projects

    • Within the same region

    Folder view (structured) vs flat view (list)

    You cannot switch between folder and flat view when you are viewing search results. Clear the search with the clear search button, or the x in the search dialog first.

    Files

    When you share the data view by sharing the link from your browser, filters and sorting is retained in links, so the recipient will see the same data and order.

    Folders

    Searching for Data

    Secondary Data

    Hyperlinking to Data

    Normal permission checks still apply with these links. If you try to follow a link to data to which you do not have access, you will be returned to the main project screen or login screen, depending on your permissions.

    Exporting the Data List

    Data Management

    To prevent cost issues, you can not perform actions such as copying and moving data which would write data to the workspace when the project billing mode is set to tenant and the owning tenant of the folder is not the current user's tenant.

    Downloading Data

    Schedule for Download

    If you do not have a connector, create one and install it. You must then return to the file selection in step 1 to use it.

    Uploading Data

    UI Upload

    Do not close the Platform Core tab in your browser while data uploads.

    Uploads via the UI are limited to 5TB and no more than 100 concurrent files at a time, but for practical and performance reasons, it is recommended to use the CLI or Service connector when uploading large amounts of data.

    Upload Data via CLI

    Copying Data

    Copying large amounts of data can take considerable time. You can monitor the progress at Projects > your_project > Activity > Batch Jobs.

    Required Rights

    Restrictions

    Data in the "Partial" or "Archived" state will be skipped during a copy job.

    Copying Data

    There is a difference in copy type behavior between copying files and folders. The behavior is designed for files and it is best practice to not copy folders if there already is a folder with the same name in the destination location.

    Copy Status

    Notes on copying data

    • Copying data comes with an additional storage cost as it will create a copy of the data.

    • Copying data from your own S3 storage requires additional configuration. See Connect AWS S3 Bucket and SSE-KMS Encryption.

    • On the command-line interface, the command to copy data is icav2 projectdata copy.

    • Before copy and move operations are executed on your own S3 storage, a test is performed to verify the necessary operational rights. This can result in temporary test files remaining (for example when is not correctly set up for a versioned bucket). These files can safely be manually deleted from your S3 console.

    Moving Data

    Move Synchronization issues

    Changes to the date during move may cause the destination data to be unsynchronized between the object store (S3) and Platform Core. To address this, create a folder session on the destination directory's parent folder by using the following API steps: Create Folder Session and Complete Folder Session. Ensure that the move job is aborted before making the create and complete requests for the folder session.

    Move jobs will fail if any data being moved is in the Partial or Archived state.

    Required Rights

    Restrictions

    Moving Data Constraints

    Move Data From

    Moving large amounts of data can take considerable time. You can monitor the progress at Projects > your_project > Activity > Batch Jobs.

    Move Data To

    Moving large amounts of data can take considerable time. You can monitor the progress at Projects > your_project > Activity > Batch Jobs.

    Move Status

    If you are only able to select your source project as the target data project, this may indicate that data sharing (Projects > your_project > Project Settings > Details > Data Sharing) is not enabled for your project or that you do not have have upload rights in other projects.

    Before copy and move operations are executed on your own S3 storage, a test is performed to verify the necessary operational rights. This can result in temporary test files remaining (for example when IAM policy is not correctly set up for a versioned bucket). These files can safely be manually deleted from your S3 console.

    Deleting, Archiving and Unarchiving

    Python Example

    The Python snippet below exemplifies the approach: it sets (or updates if set already) the time to be archived for a specific file:

    import requests
    import json
    
    from config import PROJECT_ID, DATA_ID, API_KEY
    
    url_get="https://ica.illumina.com/ica/rest/api/projects/" + PROJECT_ID + "/data/" + DATA_ID
    
    # set the API get headers
    headers = {
                'X-API-Key': API_KEY,
                'accept': 'application/vnd.illumina.v3+json'
                }
    
    # set the API put headers
    headers_put = {
                'X-API-Key': API_KEY,
                'accept': 'application/vnd.illumina.v3+json',
                'Content-Type': 'application/vnd.illumina.v3+json'
                }
    
    # Helper function to insert willBeArchivedAt after field named 'region'
    def insert_after_region(details_dict, timestamp):
        new_dict = {}
        for k, v in details_dict.items():
            new_dict[k] = v
            if k == 'region':
                new_dict['willBeArchivedAt'] = timestamp
        if 'willBeArchivedAt' in details_dict:
            new_dict['willBeArchivedAt'] = timestamp
        return new_dict
    
    # 1. Make the GET request
    response = requests.get(url_get, headers=headers)
    response_data = response.json()
    
    # 2. Modify the JSON data
    timestamp = "2024-01-26T12:00:04Z"  # Replace with the provided timestamp
    response_data['data']['details'] = insert_after_region(response_data['data']['details'], timestamp)
    
    # 3. Make the PUT request
    put_response = requests.put(url_get, data=json.dumps(response_data), headers=headers_put)
    print(put_response.status_code)

    To delete a file at specific timepoint, the key 'willBeDeletedAt' should be added or changed using the API call. If running in the terminal, a successful run will finish with the message ‘200’. In the Platform Core UI, you can check the details of the file to see the updated values for ‘Time To Be Archived’ (willBeArchivedAt) or ‘Time To Be Deleted’ (willBeDeletedAt), as shown in the screenshot.

    Linking and Unlinking

    Linking data is only possible from the root folder of your destination project. The action is disabled in project subfolders.

    Linking a parent folder after linking a file or subfolder will unlink the file or subfolder and link the parent folder. So root\linked_subfolder will become root\linked_parentfolder\linked_subfolder.

    Initial linking can take considerable time when there is a large amount of source data. However, once the initial link is made, updates to the source data will be instantaneous. You can monitor the progress at Projects > your_project > activity > Batch Jobs.

    Migrating snapshot linked data. (linked before Platform Core release v.2.29)

    Before Platform Core version v.2.29, when data was linked, a snapshot was created of the file and folder structure. These links created a read-only view of the data as it was at the time of linking, but did not propagate changes to the file and folder structure. If you want to use the advantages of the new way of linking with dynamic updates, unlink the data and relink it. Since snapshot linking has been deprecated, all new data linking done in Platform Core v.2.29 or later has dynamic content updates.

    Linking data from another project.

    Display Owning Project

    if you have selected multiple owning projects, you can add the owning project column to see which project owns the data.

    1. At the top of the screen, next to the filer icon, select the three columns.

    2. The Add/remove columns tab will appear.

    3. Choose Owning Project (or Linked Projects)

    Linking Folders

    Unlinking Project Data

    Filtering

    To add filters, select the funnel/filter symbol at the top right, next to the search field.

    Filters are reset when you exit the current screen.

    Sorting

    To sort data, select the three vertical dots in the column header on which you want to sort and chose ascending or descending.

    Sorting is retained when you exit the current screen.

    Displaying Columns

    To change which columns are displayed, select the three columns symbol and select which columns should be shown.

    In , you can see which files are externally controlled and which are ICA-managed by means of the “managed by” column.

    In view, you can jump to the folder in which files are located with the "Path" column.

    The displayed columns are retained when you exit the current screen.

    Replace

    Overwrites the existing data. Folders will copy their data in an existing folder with existing files. Existing files will be replaced when a file with the same name is copied and new files will be added. The remaining files in the target folder will remain unchanged.

    Don't copy

    The original files are kept. If you selected a folder, files that do not yet exist in the destination folder are added to it. Files that already exist at the destination are not copied over and the originals are kept.

    Keep both

    Files have a number appended to them if they already exist. If you copy folders, the folders are merged, with new files added to the destination folder and original files kept. New files with the same name get copied over into the folder with a number appended.

    secondaryFiles
    Activity
    CLI Data Transfer
    GET
    PUT
    Non-indexed folders
    Moving Data
    • Upload rights

    • Contributor rights

    • No linked data

    • Within the same region

    • Upload rights

    • Viewer rights

    • No linked data

    • Within same region

    IAM policy
    externally-managed projects
    flat
    Owning Project Filter

    Cohorts Data in Base

    Platform Core Cohorts data can be viewed in a Platform Core Project Base instance as a shared database. A shared database in Platform Core Base operates as a database view. To use this feature, enable Base for your project prior to starting any Platform Core Cohorts ingestions. See Base for more information on enabling this feature in your Platform Core Project.

    Platform Core Cohorts Base Tables

    After ingesting data into your project, select Phenotypic and Molecular data are available to view in Base. See Cohorts Import for instruction on importing data sets into Cohorts.

    1. Post ingestion, data will be represented in Base.

    2. Select BASE from the Platform Core left navigation and click Query.

    3. Under the New Query window, a list of tables is displayed. Expand the Shared Database for Project <your_project>.

    4. Cohorts tables will be displayed.

    5. To preview the table and fields click each listed view.

    6. Clicking any of these views then selecting Preview on the right-hand side will show you a preview of the data in the tables.

    Field Name
    Type
    Description
    Field Name
    Type
    Description

    This table is an entity-attribute value table of supplied sample data matching Cohorts accepted attributes.

    Field Name
    Type
    Description
    Field Name
    Type
    Description
    Field
    Type
    Description

    This table is an entity-attribute value table of supplied subject data matching Cohorts accepted attributes.

    Field
    Type
    Description
    Field
    Type
    Description
    Field
    Type
    Description
    Field
    Type
    Description
    Field
    Type
    Description

    This table will be available for all projects with ingested molecular data

    This table will only be available for data sets with ingested Somatic molecular data.

    This table will only be available for data sets with ingested CNV molecular data.

    This table will only be available for data sets with ingested SV molecular data. Note that Platform Core Cohorts stores copy number variants in a separate table.

    These tables will only be available for data sets with ingested RNAseq molecular data.

    Table for gene quantification results:

    The corresponding transcript table uses TRANSCRIPT_ID instead of GENE_ID and GENE_HGNC.

    These tables will only be available for data sets with ingested RNAseq molecular data.

    Table for differential gene expression results:

    The corresponding transcript table uses TRANSCRIPT_ID instead of GENE_ID and GENE_HGNC.

    Releases

    Find the links to CLI builds in the Releases section below.

    In the below, select the matching operating system in the link column for the version you want to install. This will download the installer for that operating system.

    To determine which CLI version you are currently using, navigate to your currently installed CLI and use the CLI command icav2 version For help on this command use icav2 version -h.

    Checksums are provided alongside each downloadable CLI binary to verify file integrity. The checksums are generated using the SHA256 algorithm. To use the checksums:

    STUDY

    STRING

    Study designation

    AGE

    NUMERIC

    Age in years

    SEX

    STRING

    Sex field to drive annotation

    POPULATION

    STRING

    Population Designation for 1000 Genomes Project

    SUPERPOPULATION

    STRING

    Superpopulation Designation from 1000 Genomes Project

    RACE

    STRING

    Race according to NIH standard

    CONDITION_ONTOLOGIES

    VARIANT

    Diagnosis Ontology Source

    CONDITION_IDS

    VARIANT

    Diagnosis Concept Ids

    CONDITIONS

    VARIANT

    Diagnosis Names

    HARMONIZED_CONDITIONS

    VARIANT

    Diagnosis High-level concept to drive UI

    LIBRARYTYPE

    STRING

    Seqencing technology

    ANALYTE

    STRING

    Substance sequenced

    TISSUE

    STRING

    Tissue source

    TUMOR_OR_NORMAL

    STRING

    Tumor designation for somatic

    GENOMEBUILD

    STRING

    Genome Build to drive annotations - hg38 only

    SAMPLE_BARCODE_VCF

    STRING

    Sample ID from VCF

    AFFECTED_STATUS

    NUMERIC

    Affected, Unaffected, or Unknown for Family Based Analysis

    FAMILY_RELATIONSHIP

    STRING

    Relationship designation for Family Based Analysis

    DATATYPE

    ARRAY

    The categorization of molecular data

    TECHNOLOGY

    ARRAY

    The sequencing method

    CREATEDATE

    DATE

    Date and time of record creation

    LASTUPDATEDATE

    DATE

    Date and time of last update of record

    ATTRIBUTE_NAME

    STRING

    Cohorts meta-data driven field name

    ATTRIBUTE_VALUE

    VARIANT

    List of values entered for the field

    LASTUPDATEDATE

    DATE

    Data and time of record update

    SEX

    STRING

    -

    ETHNICITY

    STRING

    -

    STUDY

    STRING

    Study subject belongs to

    CREATEDATE

    DATE

    Date and time of record creation

    LASTUPDATEDATE

    DATE

    Date and time of record update

    ATTRIBUTE_VALUE

    VARIANT

    List of values entered for the field

    OCCURRENCES

    STRING

    List of occurrence related data

    OCCURRENCES

    STRING

    List of occurrence related data of drug exposure

    OCCURRENCES

    STRING

    List of occurrences and values related to lab or measurement data

    OCCURRENCES

    STRING

    List of occurrences and values related procedure data

    GENOMEBUILD

    STRING

    Only hg38 is supported

    CHROMOSOME

    STRING

    Chromosome without 'chr' prefix

    CHROMOSOMEID

    NUMERIC

    Chromosome ID: 1..22, 23=X, 24=Y, 25=Mt

    DBSNP

    STRING

    dbSNP Identifiers

    VARIANT_KEY

    STRING

    Variant ID in the form "1:12345678:12345678:C"

    NIRVANA_VID

    STRING

    Broad Institute VID: "1-12345678-A-C"

    VARIANT_TYPE

    STRING

    Description of Variant Type (e.g. SNV, Deletion, Insertion)

    VARIANT_CALL

    NUMERIC

    1=germline, 2=somatic

    DENOVO

    BOOLEAN

    true / false

    GENOTYPE

    STRING

    "G|T"

    READ_DEPTH

    NUMERIC

    Sequencing read depth

    ALLELE_COUNT

    NUMERIC

    Counts of each alternate allele for each site across all samples

    ALLELE_DEPTH

    STRING

    Unfiltered count of reads that support a given allele for an individual sample

    FILTERS

    STRING

    Filter field from VCF. If all filters pass, field is PASS

    ZYGOSITY

    NUMERIC

    0 = hom ref, 1 = het ref/alt, 2 = hom alt, 4 = hemi alt

    GENEMODEL

    NUMERIC

    1=Ensembl, 2=RefSeq

    GENE_HGNC

    STRING

    HUGO/HGNC gene symbol

    GENE_ID

    STRING

    Ensembl gene ID ("ENSG00001234")

    GID

    NUMERIC

    NCBI Entrez Gene ID (RefSeq) or numerical part of Ensembl ENSG ID

    TRANSCRIPT_ID

    STRING

    Ensembl ENST or RefSeq NM_

    CANONICAL

    STRING

    Transcript designated 'canonical' by source

    CONSEQUENCE

    STRING

    missense, stop gained, intronic, etc.

    HGVSC

    STRING

    The HGVS coding sequence name

    HGVSP

    STRING

    The HGVS protein sequence name

    STUDY

    STRING

    Study designation

    GENOMEBUILD

    STRING

    Only hg38 is supported

    CHROMOSOME

    STRING

    Chromosome without 'chr' prefix

    DBSNP

    NUMERIC

    dbSNP Identifiers

    VARIANT_KEY

    STRING

    Variant ID in the form "1:12345678:12345678:C"

    MUTATION_TYPE

    NUMERIC

    Rank of consequences by expected impact: 0 = Protein Truncating to 40 = Intergenic Variant

    VARIANT_CALL

    NUMERIC

    1=germline, 2=somatic

    GENOTYPE

    STRING

    "G|T"

    REF_ALLELE

    STRING

    Reference allele

    ALLELE1

    STRING

    First allele call in the tumor sample

    ALLELE2

    STRING

    Second allele call in the tumor sample

    GENEMODEL

    NUMERIC

    1=Ensembl, 2=RefSeq

    GENE_HGNC

    STRING

    HUGO/HGNC gene symbol

    GENE_ID

    STRING

    Ensembl gene ID ("ENSG00001234")

    TRANSCRIPT_ID

    STRING

    Ensembl ENST or RefSeq NM_

    CANONICAL

    BOOLEAN

    Transcript designated 'canonical' by source

    CONSEQUENCE

    STRING

    missense, stop gained, intronic, etc.

    HGVSP

    STRING

    HGVS nomenclature for AA change: p.Pro72Ala

    NIRVANA_VID

    STRING

    Variant ID of the form 'chr-pos-ref-alt'

    CHRID

    STRING

    Chromosome without 'chr' prefix

    CID

    NUMERIC

    Numerical representation of the chromosome, X=23, Y=24, Mt=25

    GENE_ID

    STRING

    NCBI or Ensembl gene identifier

    GID

    NUMERIC

    Numerical part of the gene ID; for Ensembl, we remove the 'ENSG000..' prefix

    START_POS

    NUMERIC

    First affected position on the chromosome

    STOP_POS

    NUMERIC

    Last affected position on the chromosome

    VARIANT_TYPE

    NUMERIC

    1 = copy number gain, -1 = copy number loss

    COPY_NUMBER

    NUMERIC

    Observed copy number

    COPY_NUMBER_CHANGE

    NUMERIC

    Fold-chang of copy number, assuming 2 for diploid and 1 for haploid as the baseline

    SEGMENT_VALUE

    NUMERIC

    Average FC for the identified chromosomal segment

    PROBE_COUNT

    NUMERIC

    Probes confirming the CNV (arrays only)

    REFERENCE

    NUMERIC

    Baseline taken from normal samples (1) or averaged disease tissue (2)

    GENE_HGNC

    STRING

    HUGO/HGNC gene symbol

    NIRVANA_VID

    STRING

    Variant ID of the form 'chr-pos-ref-alt'

    CHRID

    STRING

    Chromosome without 'chr' prefix

    CID

    NUMERIC

    Numerical representation of the chromosome, X=23, Y=24, Mt=25

    BEGIN

    NUMERIC

    First affected position on the chromosome

    END

    NUMERIC

    Last affected position on the chromosome

    BAND

    STRING

    Chromosomal band

    QUALIITY

    NUMERIC

    Quality from the original VCF

    FILTERS

    ARRAY

    Filters from the original VCF

    VARIANT_TYPE

    STRING

    Insertion, deletion, indel, tandem_duplication, translocation_breakend, inversion ("INV"), short tandem repeat ("STR2")

    VARIANT_TYPE_ID

    NUMERIC

    21=insertion, 22=deletion, 23=indel, 24=tandem_duplication, 25=translocation_breakend, 26=inversion ("INV"), 27=short tandem repeat ("STR2")

    CIPOS

    ARRAY

    Confidence interval around first position

    CIEND

    ARRAY

    Confidence interval around last position

    SVLENGTH

    NUMERIC

    Overall size of the structural variant

    BONDCHR

    STRING

    For translocations, the other affected chromosome

    BONDCID

    NUMERIC

    For translocations, the other affected chromosome as a numeric value, X=23, Y=24, Mt=25

    BONDPOS

    STRING

    For translocations, positions on the other affected chromosome

    BONDORDER

    NUMERIC

    3 or 5: Whether this fragment (the current variant/VID) "receives" the other chromosome's fragment on it's 3' end, or attaches to the 5' of the other chromosome fragment

    GENOTYPE

    STRING

    Called genotype from the VCF

    GENOTYPE_QUALITY

    NUMERIC

    Genotype call quality

    READCOUNTSSPLIT

    ARRAY

    Read counts

    READCOUNTSPAIRED

    ARRAY

    Read counts, paired end

    REGULATORYREGIONID

    STRING

    Ensembl ID for the affected regulatory region

    REGULATORYREGIONTYPE

    STRING

    Type of the regulatory region

    CONSEQUENCE

    ARRAY

    Variant consequence according to SequenceOntology

    TRANSCRIPTID

    STRING

    Ensembl of RefSeq transcript identifier

    TRANSCRIPTBIOTYPE

    STRING

    Biotype of the transcript

    INTRONS

    STRING

    Count of impacted introns out of the total number of introns, specified as "M/N"

    GENEID

    STRING

    Ensembl or RefSeq gene identifier

    GENEHGNC

    STRING

    HUGO/HGNC gene symbol

    ISCANONICAL

    BOOLEAN

    Is the transcript ID the canonical one according to Ensembl?

    PROTEINID

    STRING

    RefSeq or Ensembl protein ID

    SOURCEID

    NUMERICAL

    Gene model: 1=Ensembl, 2=RefSeq

    SAMPLE_BARCODE

    STRING

    Sample barcode used in the original VCF

    LABEL

    STRING

    Group label specified during import: Case or Control, Tumor or Normal, etc.

    GENE_ID

    STRING

    Ensembl or RefSeq gene identifier

    GID

    NUMERIC

    Numerical part of the gene ID; for Ensembl, we remove the 'ENSG000..' prefix

    GENE_HGNC

    STRING

    HUGO/HGNC gene symbol

    SOURCE

    STRING

    Gene model: 1=Ensembl, 2=RefSeq

    TPM

    NUMERICAL

    Transcripts per million

    LENGTH

    NUMERICAL

    The length of the gene in base pairs.

    EFFECTIVE_LENGTH

    NUMERICAL

    The length as accessible to RNA-seq, accounting for insert-size and edge effects.

    NUM_READS

    NUMERICAL

    The estimated number of reads from the gene. The values are not normalized.

    SAMPLE_BARCODE

    STRING

    Sample barcode used in the original VCF

    CASE_LABEL

    STRING

    Study designation

    GENE_ID

    STRING

    Ensembl or RefSeq gene identifier

    GID

    NUMERIC

    Numerical part of the gene ID; for Ensembl, we remove the 'ENSG000..' prefix

    GENE_HGNC

    STRING

    HUGO/HGNC gene symbol

    SOURCE

    STRING

    Gene model: 1=Ensembl, 2=RefSeq

    BASEMEAN

    NUMERICAL

    FC

    NUMERICAL

    Fold-change

    LFC

    NUMERICAL

    Log of the fold-change

    LFCSE

    NUMERICAL

    Standard error for log fold-change

    PVALUE

    NUMERICAL

    P-value

    CONTROL_SAMPLECOUNT

    NUMERICAL

    Number of samples used as control

    CONTROL_LABEL

    NUMERICAL

    Label used for controls

    SAMPLE_BARCODE

    STRING

    Sample Identifier

    SUBJECTID

    STRING

    Identifer for Subject entity

    SAMPLE_BARCODE

    STRING

    Original sample barcode used in VCF column

    SUBJECTID

    STRING

    Original identifier for the subject record

    SAMPLE_ BARCODE

    STRING

    Original sample barcode used in VCF column

    SUBJECTID

    STRING

    Original identifier for the subject record

    NAME

    STRING

    Study name

    CREATEDATE

    DATE

    Date and time of study creation

    SUBJECTID

    STRING

    Original identifier for the subject record

    AGE

    FLOAT

    Age entered on subject record if applicable

    SUBJECTID

    STRING

    Original identifier for the subject record

    ATTRIBUTE_NAME

    STRING

    Cohorts meta-data driven field name

    SUBJECTID

    STRING

    Original identifier for the subject record

    TERM

    STRING

    Code for disease term

    SUBJECTID

    STRING

    Original identifier for the subject record

    TERM

    STRING

    Code for drug term

    SUBJECTID

    STRING

    Original identifier for the subject record

    TERM

    STRING

    Code for measurement term

    SUBJECTID

    STRING

    Original identifier for the subject record

    TERM

    STRING

    Code for procedure term

    Field Name

    Type

    Description

    SAMPLE_BARCODE

    STRING

    Original sample barcode used in VCF column

    STUDY

    STRING

    Field Name

    Type

    Description

    SAMPLE_BARCODE

    STRING

    Original sample barcode, used in VCF column

    SUBJECTID

    STRING

    Field Name

    Type

    Description

    SAMPLE_BARCODE

    STRING

    Sample barcode used in the original VCF

    GENOMEBUILD

    STRING

    Field Name

    Type

    Description

    SAMPLE_BARCODE

    STRING

    Sample barcode used in the original VCF

    GENOMEBUILD

    STRING

    Field Name

    Type

    Description

    GENOMEBUILD

    STRING

    Genome build, always 'hg38'

    STUDY_NAME

    STRING

    Field Name

    Type

    Description

    GENOMEBUILD

    STRING

    Genome build, always 'hg38'

    STUDY_NAME

    STRING

    If your ingestion includes Somatic variants, there will be two molecular tables: ANNOTATED_SOMATIC_MUTATIONS and ANNOTATED_VARIANTS. All ingestions will include a PHENOTYPE table.

    The PHENOTYPE table includes a harmonized set that is collected across all data ingestions and is not representative of all data ingested for the Subject or Sample. Sample information is also displayed in this table, if applicable. Sample information drives the annotation process if molecular data is included in the ingestion. That data is stored in the PHENOTYPE table.

    Phenotype Data

    Sample Information

    Sample Attribute

    Study Information

    Subject

    Subject Attribute

    Disease

    Drug Exposure

    Measurement

    Procedure

    Annotated Variants

    Annotated Somatic Mutations

    Annotated Copy Number Variants

    Annotated Structural Variants

    Raw RNAseq data tables for genes and transcripts

    Differential expression tables for genes and transcripts

    Study designation

    Identifier for Subject entity

    Genome build, always 'hg38'

    Genome build, always 'hg38'

    Study designation

    Study designation

    Download the CLI binary for your OS

  • Download the corresponding checksum using the links in the table

  • Calculate the SHA256 checksum of the downloaded CLI binary

  • Diff the calculated SHA256 checksum with the downloaded checksum. If the checksums match, the integrity is confirmed.

  • There are a variety of open source tools for calculating the SHA256 checksum. See the below tables for examples.

    For CLI v2.3.0 and later:

    OS
    Command

    Windows

    CertUtil -hashfile ica-windows-amd64.zip SHA256

    Linux

    sha256sum ica-linux-amd64.zip

    Mac

    shasum -a 256 ica-darwin-amd64.zip

    Version
    Link
    Checksum

    2.47

    Downloading the Installer

    Version Check

    Integrity Check

    Releases section
    For CLI v2.2.0
    OS
    Command

    Releases

    To access release history of CLI versions prior to v2.0.0, please see the Illumina Connected Analytics v1 documentation .

    sha256sum icav2

    Mac

    shasum -a 256 icav2

    linux

    sha256

    2.46

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.45

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.44

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.43

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.42

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.41

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.40

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.39.0

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.38.0

    No changes, use 2.37.0

    -

    2.37.0

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.36.0

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.35.0

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.34.0

    Mac

    sha256

    windows

    sha256

    linux

    sha256

    2.33.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.32.2

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.31.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.30.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.29.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.28.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.27.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.26.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.25.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.24.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.23.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.22.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.21.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.19.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.18.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.17.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.16.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.15.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.12.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.10.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.9.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.8.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.4.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.3.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.2.0

    mac

    sha256

    windows

    sha256

    linux

    sha256

    2.1.0

    mac

    windows

    linux

    2.0.0

    mac

    windows

    linux

    Windows

    CertUtil -hashfile icav2.exe SHA256

    Linux

    Mac
    sha256
    windows
    sha256
    here

    Command Index

    The build number, together with the used libraries and licenses are provided in the accompanying readme file.

    icav2

    Command line interface for the Illumina Connected Analytics, a genomics platform-as-a-service
    
    Usage:
      icav2 [command]
    
    Available Commands:
      analysisstorages      Analysis storages commands
      completion            Generate the autocompletion script for the specified shell
      config                Config actions
      dataformats           Data format commands
      help                  Help about any command
      jobs                  Job commands
      metadatamodels        Metadata model commands
      pipelines             Pipeline commands
      projectanalyses       Project analyses commands
      projectdata           Project Data commands
      projectpipelines      Project pipeline commands
      projects              Project commands
      projectsamples        Project samples commands
      regions               Region commands
      storagebundles        Storage bundle commands
      storageconfigurations Storage configurations commands
      tokens                Tokens commands
      version               The version of this application
    
    Flags:
      -t, --access-token string    JWT used to call rest service
      -h, --help                   help for icav2
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -v, --version                version for icav2
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 [command] --help" for more information about a command.

    icav2 analysisstorages

    This is the root command for actions that act on analysis storages
    
    Usage:
      icav2 analysisstorages [command]
    
    Available Commands:
      list        list of storage id's
    
    Flags:
      -h, --help   help for analysisstorages
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 analysisstorages [command] --help" for more information about a command.

    icav2 analysisstorages list

    This command lists all the analysis storage id's
    
    Usage:
      icav2 analysisstorages list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 completion

    This command generates custom completion functions for icav2 tool. These functions facilitate the generation of context-aware suggestions based on the user's input and specific directives provided by the icav2 tool. For example, for ZSH shell the completion function _icav2() is generated. It could provide suggestions for available commands, flags, and arguments depending on the context, making it easier for the user to interact with the tool without having to constantly refer to documentation.

    To enable this custom completion function, you would typically include it in your Zsh configuration (e.g., in .zshrc or a separate completion script) and then use the compdef command to associate the function with the icav2 command:

    compdef _icav2 icav2

    This way, when the user types icav2 followed by a space and presses the TAB key, Zsh will call the _icav2 function to provide context-aware suggestions based on the user's input and the icav2 tool's directives.

    Generate the autocompletion script for icav2 for the specified shell.
    See each sub-command's help for details on how to use the generated script.
    
    Usage:
      icav2 completion [command]
    
    Available Commands:
      bash        Generate the autocompletion script for bash
      fish        Generate the autocompletion script for fish
      powershell  Generate the autocompletion script for powershell
      zsh         Generate the autocompletion script for zsh
    
    Flags:
      -h, --help   help for completion
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 completion [command] --help" for more information about a command.

    icav2 completion bash

    Generate the autocompletion script for the bash shell.
    
    This script depends on the 'bash-completion' package.
    If it is not installed already, you can install it via your OS's package manager.
    
    To load completions in your current shell session:
    
    	source <(icav2 completion bash)
    
    To load completions for every new session, execute once:
    
    #### Linux:
    
    	icav2 completion bash > /etc/bash_completion.d/icav2
    
    #### macOS:
    
    	icav2 completion bash > $(brew --prefix)/etc/bash_completion.d/icav2
    
    You will need to start a new shell for this setup to take effect.
    
    Usage:
      icav2 completion bash
    
    Flags:
      -h, --help              help for bash
          --no-descriptions   disable completion descriptions
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 completion fish

    Generate the autocompletion script for the fish shell.
    
    To load completions in your current shell session:
    
    	icav2 completion fish | source
    
    To load completions for every new session, execute once:
    
    	icav2 completion fish > ~/.config/fish/completions/icav2.fish
    
    You will need to start a new shell for this setup to take effect.
    
    Usage:
      icav2 completion fish [flags]
    
    Flags:
      -h, --help              help for fish
          --no-descriptions   disable completion descriptions
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 completion powershell

    Generate the autocompletion script for powershell.
    
    To load completions in your current shell session:
    
    	icav2 completion powershell | Out-String | Invoke-Expression
    
    To load completions for every new session, add the output of the above command
    to your powershell profile.
    
    Usage:
      icav2 completion powershell [flags]
    
    Flags:
      -h, --help              help for powershell
          --no-descriptions   disable completion descriptions
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 completion zsh

    Generate the autocompletion script for the zsh shell.
    
    If shell completion is not already enabled in your environment you will need
    to enable it.  You can execute the following once:
    
    	echo "autoload -U compinit; compinit" >> ~/.zshrc
    
    To load completions in your current shell session:
    
    	source <(icav2 completion zsh)
    
    To load completions for every new session, execute once:
    
    #### Linux:
    
    	icav2 completion zsh > "${fpath[1]}/_icav2"
    
    #### macOS:
    
    	icav2 completion zsh > $(brew --prefix)/share/zsh/site-functions/_icav2
    
    You will need to start a new shell for this setup to take effect.
    
    Usage:
      icav2 completion zsh [flags]
    
    Flags:
      -h, --help              help for zsh
          --no-descriptions   disable completion descriptions
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 config

    Config command provides functions for CLI configuration management.
    
    Usage:
      icav2 config [command]
    
    Available Commands:
      get         Get configuration information
      reset       Remove the configuration information
      set         Set configuration information
    
    Flags:
      -h, --help   help for config
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 config [command] --help" for more information about a command.

    icav2 config get

    Get configuration information.
    
    Usage:
      icav2 config get [flags]
    
    Flags:
      -h, --help   help for get

    icav2 config reset

    Remove configuration information.
    
    Usage:
      icav2 config reset [flags]
    
    Flags:
      -h, --help   help for reset

    icav2 config set

    Set configuration information. Following information is asked when starting the command : 
    
     - server-url : used to form the url for the rest api's. 
     - x-api-key : api key used to fetch the JWT used to authenticate to the API server. 
     - colormode : set depending on your background color of your terminal. Input's and errors are colored. Default is 'none', meaning that no colors will be used in the output.
     - table-format : Output layout, defaults to a table, other allowed values are json and yaml
    
    Usage:
      icav2 config set [flags]
    
    Flags:
      -h, --help   help for set

    icav2 dataformats

    This is the root command for actions that act on Data formats
    
    Usage:
      icav2 dataformats [command]
    
    Available Commands:
      list        List data formats
    
    Flags:
      -h, --help   help for dataformats
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 dataformats [command] --help" for more information about a command.

    icav2 dataformats list

    This command lists the data formats you can use inside of a project
    
    Usage:
      icav2 dataformats list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 help

    Help provides help for any command in the application.
    Simply type icav2 help [path to command] for full details.
    
    Usage:
      icav2 help [command] [flags]
    
    Flags:
      -h, --help   help for help
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 jobs

    This is the root command for actions that act on jobs
    
    Usage:
      icav2 jobs [command]
    
    Available Commands:
      get         Get details of a job
    
    Flags:
      -h, --help   help for jobs
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 jobs [command] --help" for more information about a command.

    icav2 jobs get

    This command fetches the details of a job using the argument as an id (uuid).
    
    Usage:
      icav2 jobs get [job id] [flags]
    
    Flags:
      -h, --help   help for get
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 metadatamodels

    This is the root command for actions that act on metadata models
    
    Usage:
      icav2 metadatamodels [command]
    
    Available Commands:
      list        list of metadata models
    
    Flags:
      -h, --help   help for metadatamodels
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 metadatamodels [command] --help" for more information about a command.

    icav2 metadatamodels list

    This command lists all the metadata models
    
    Usage:
      icav2 metadatamodels list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 pipelines

    This is the root command for actions that act on pipelines
    
    Usage:
      icav2 pipelines [command]
    
    Available Commands:
      get         Get details of a pipeline
      list        List pipelines
    
    Flags:
      -h, --help   help for pipelines
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 pipelines [command] --help" for more information about a command.

    icav2 pipelines get

    This command fetches the details of a pipeline without a project context
    
    Usage:
      icav2 pipelines get [pipeline id] [flags]
    
    Flags:
      -h, --help   help for get
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 pipelines list

    This command lists the pipelines without the context of a project
    
    Usage:
      icav2 pipelines list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectanalyses

    This is the root command for actions that act on projects analysis
    
    Usage:
      icav2 projectanalyses [command]
    
    Available Commands:
      get         Get the details of an analysis 
      input       Retrieve input of analyses commands
      list        List of analyses for a project 
      output      Retrieve output of analyses commands
      update      Update tags of analyses
    
    Flags:
      -h, --help   help for projectanalyses
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projectanalyses [command] --help" for more information about a command.

    icav2 projectanalyses get

    This command returns all the details of a analysis.
    
    Usage:
      icav2 projectanalyses get [analysis id] [flags]
    
    Flags:
      -h, --help                help for get
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectanalyses input

    Retrieve input of analyses commands
    
    Usage:
      icav2 projectanalyses input [analysisId] [flags]
    
    Flags:
      -h, --help                help for input
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectanalyses list

    This command lists the analyses for a given project. Sorting can be done on 
    - reference
    - userReference
    - pipeline
    - status
    - startDate
    - endDate
    - summary
    
    Usage:
      icav2 projectanalyses list [flags]
    
    Flags:
      -h, --help                help for list
          --max-items int       maximum number of items to return, the limit and default is 1000
          --page-offset int     Page offset, only used in combination with sort-by. Offset-based pagination has a result limit of 200K rows and does not guarantee unique results across pages
          --page-size int32     Page size, only used in combination with sort-by. The amount of rows to return. Use in combination with the offset or cursor parameter to get subsequent results. Default and max value of pagesize=1000 (default 1000)
          --project-id string   project ID to set current project context
          --sort-by string      specifies the order to list items
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectanalyses output

    Retrieve output of analyses commands
    
    Usage:
      icav2 projectanalyses output [analysisId] [flags]
    
    Flags:
      -h, --help                help for output
          --project-id string   project ID to set current project context
          --raw-output          Add this flag if output should be in raw format. Applies only for Cwl pipelines ! This flag needs no value, adding it sets the value to true.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectanalyses update

    Updates the user and technical tags of an analysis
    
    Usage:
      icav2 projectanalyses update [analysisId] [flags]
    
    Flags:
          --add-tech-tag stringArray      Tech tag to add to analysis. Add flag multiple times for multiple values.
          --add-user-tag stringArray      User tag to add to analysis. Add flag multiple times for multiple values.
      -h, --help                          help for update
          --project-id string             project ID to set current project context
          --remove-tech-tag stringArray   Tech tag to remove from analysis. Add flag multiple times for multiple values.
          --remove-user-tag stringArray   User tag to remove from analysis. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectdata

    This is the root command for actions that act on projects data
    
    Usage:
      icav2 projectdata [command]
    
    Available Commands:
      archive              archive data 
      copy                 Copy data to a project
      create               Create data id for a project
      delete               delete data 
      download             Download a file/folder
      downloadurl          get download url 
      folderuploadsession  Get details of a folder upload
      get                  Get details of a data
      link                 Link data to a project
      list                 List data 
      mount                Mount project data 
      move                 Move data to a project
      temporarycredentials fetch temporal credentials for data
      unarchive            unarchive data 
      unlink               Unlink data to a project
      unmount              Unmount project data 
      update               Updates the details of a data
      upload               Upload a file/folder
    
    Flags:
      -h, --help   help for projectdata
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projectdata [command] --help" for more information about a command.

    icav2 projectdata archive

    This command archives data for a given project
    
    Usage:
      icav2 projectdata archive [path or data Id] [flags]
    
    Flags:
      -h, --help                help for archive
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectdata copy

    This command copies data between projects. Use data id or a combination of path and --source-project-id to identify the source data. By default, the root folder of your current project will be used as destination. If you want to specify a destination, use --destination-folder to specify the destination path or folder id.
    
    Usage:
      icav2 projectdata copy [data id] or [path] [flags]
    
    Flags:
          --action-on-exist string      what to do when a file or folder with the same name already exists: OVERWRITE|SKIP|RENAME (default "SKIP")
          --background                  starts job in background on server. Does not provide upload progress updates. Use icav2 jobs get with the current job.id value
          --copy-instrument-info        copy instrument info form source data to destination data
          --copy-technical-tags         copy technical tags form source data to destination data
          --copy-user-tags              copy user tags form source data to destination data
          --destination-folder string   folder id or path to where you want to copy the data, default root of project
      -h, --help                        help for copy
          --polling-interval int        polling interval in seconds for job status, values lower than 30 will be set to 30 (default 30)
          --project-id string           project ID to set current project context
          --source-project-id string    project ID from where the data needs to be copied, mandatory when using source path notation
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectdata create

    This command creates a data on a project. It takes name of file/folder as an argument
    
    Usage:
      icav2 projectdata create [name] [flags]
    
    Flags:
          --data-type string     (*) Data type : FILE or FOLDER
          --folder-id string     Id of the folder
          --folder-path string   Folder path under which the new project data will be created.
          --format string        Only allowed for file, sets the format of the file.
      -h, --help                 help for create
          --project-id string    project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectdata delete

    This command deletes data for a given project
    
    Usage:
      icav2 projectdata delete [path or dataId] [flags]
    
    Flags:
      -h, --help                help for delete
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    icav2 projectdata download

    Download a file/folder.  Source path can be a data id or a path. Source path for download of a folder should end with '*'. For files : Target defines either local folder into which the download will occur, or a path with a new name for the file. If the  file already exists locally, it is overwritten. For folders : If folder does not exist locally, it will be created automatically. Overwrite of an existing folder will need to be acknowledged.
    
    Usage:
      icav2 projectdata download [source data id or path] [target path] [flags]
    
    Flags:
          --exclude string        Regex filter for file names to exclude from download.
          --exclude-source-path   Indicates that on folder download, the CLI will not create the parent folders of the downloaded folder in ICA on your local machine.
      -h, --help                  help for download
          --project-id string     project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service

    Example 1

    Using this command all the files starting with VariantCaller- will be downloaded (prerequisite: a tool is installed on the machine):

    Example 2

    Here an example of how to download all BAM files from a project (we are using some jq features to remove '.bam.bai' and '.bam.md5sum' files)

    Tip: If you want to look up a file id from the GUI, go to that file and open te details view. The file id can be found on the top left side and will begin with fil.

    It is best practice to always surround your path with quotes if you want to use the * wildcard. Otherwise, you may run into situations where the command results in "accepts at most 1 arg(s), received x" as it returns folders with the same name, but different amounts of subfolders.

    For more information on how to use pagination, please refer to

    If you want to look up a file id from the GUI, go to that file and open te details view. The file id can be found on the top left side and will begin with fil.

    Example to list files in the folder SOURCE

    Example to list only subfolders in the folder SOURCE

    Example for uploading multiple files

    In this example all the fastq.gz files from source will be uploaded to target using xargs utility.

    Example for uploading multiple files using a CSV file

    In this example we upload multiple bam files specified with the corresponding path in the file bam_files.csv. The files will be renamed. We are using screen in detached mode (this creates a new session but not attaching to it):

    icav2 projectpipelines create cwl

    icav2 projectpipelines create cwljson

    icav2 projectpipelines create nextflow

    icav2 projectpipelines create nextflowjson

    icav2 projectpipelines start cwl

    icav2 projectpipelines start cwljson

    Field definition

    A field can only have values (--field) and a data field can only have datavalues (--field-data). To create multiple fields or data fields, you have to repeat the flag.

    For example

    matches

    The following example with --field and --field-data

    matches

    Group definition

    A group will only have values (--group) and a data group can only have datavalues (--group-data). Add flags multiple times for multiple groups and fields in the group.

    icav2 projectpipelines start nextflow

    icav2 projectpipelines start nextflowjson

    Field definition

    A field can only have values (--field) and a data field can only have datavalues (--field-data). To create multiple fields or data fields, you have to repeat the flag.

    For example

    matches

    The following example with --field and --field-data

    matches

    Group definition

    A group will only have values (--group) and a data group can only have datavalues (--group-data). Add flags multiple times for multiple groups and fields in the group.

    icav2 projectdata downloadurl

    icav2 projectdata folderuploadsession

    icav2 projectdata get

    icav2 projectdata link

    icav2 projectdata list

    icav2 projectdata mount

    icav2 projectdata move

    icav2 projectdata temporarycredentials

    icav2 projectdata unarchive

    icav2 projectdata unlink

    icav2 projectdata unmount

    icav2 projectdata update

    icav2 projectdata upload

    icav2 projectpipelines

    icav2 projectpipelines create

    icav2 projectpipelines input

    icav2 projectpipelines link

    icav2 projectpipelines list

    icav2 projectpipelines start

    icav2 projectpipelines unlink

    icav2 projects

    icav2 projects create

    icav2 projects enter

    icav2 projects exit

    icav2 projects get

    icav2 projects list

    icav2 projectsamples

    icav2 projectsamples complete

    icav2 projectsamples create

    icav2 projectsamples delete

    icav2 projectsamples get

    icav2 projectsamples link

    icav2 projectsamples list

    icav2 projectsamples listdata

    icav2 projectsamples unlink

    icav2 projectsamples update

    icav2 regions

    icav2 regions list

    icav2 storagebundles

    icav2 storagebundles list

    icav2 storageconfigurations

    icav2 storageconfigurations list

    icav2 tokens

    icav2 tokens create

    icav2 tokens refresh

    icav2 version

    jq
    Cursor- versus Offset-based Pagination
    icav2 projectdata list --data-type FILE --file-name VariantCaller- --match-mode FUZZY -o json | jq -r '.items[].id' > filelist.txt; for item in $(cat filelist.txt); do echo "--- $item ---"; icav2 projectdata download $item . ; done;
    icav2 projectdata list --file-name .bam --match-mode FUZZY -o json | jq -r '.items[] | select(.details.format.code == "BAM") | [.id] | @tsv' > filelist.txt; for item in $(cat filelist.txt); do echo "--- $item ---"; icav2 projectdata download $item . ; done
    This command returns the data download url for a given project
    
    Usage:
      icav2 projectdata downloadurl [path or data Id] [flags]
    
    Flags:
      -h, --help                help for downloadurl
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command fetches the details a folder upload
    
    Usage:
      icav2 projectdata folderuploadsession [project id] [data id] [folder upload session id] [flags]
    
    Flags:
      -h, --help                help for folderuploadsession
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command fetches the details a data
    
    Usage:
      icav2 projectdata get [data id] or [path] [flags]
    
    Flags:
      -h, --help                help for get
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This links data to a project. Use data id or the path + the source project flag identify the data.
    
    Usage:
      icav2 projectdata link [data id] or [path] [flags]
    
    Flags:
      -h, --help                       help for link
          --project-id string          project ID to set current project context
          --source-project-id string   project ID from where the data needs to be linked
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command lists the data for a given project. Page-offset can only be used in combination with sort-by. Sorting can be done on 
    - timeCreated
    - timeModified
    - name
    - path
    - fileSizeInBytes
    - status
    - format
    - dataType
    - willBeArchivedAt
    - willBeDeletedAt
    
    Usage:
      icav2 projectdata list [path] [flags]
    
    Flags:
          --data-type string        Data type. Available values : FILE or FOLDER
          --eligible-link           Add this flag if output should contain only the data that is eligible for linking on the current project. This flag needs no value, adding it sets the value to true.
          --file-name stringArray   The filenames to filter on. The filenameMatchMode-parameter determines how the filtering is done. Add flag multiple times for multiple values.
      -h, --help                    help for list
          --match-mode string       Match mode for the file name. Available values : EXACT (default), EXCLUDE, FUZZY.
          --max-items int           maximum number of items to return, the limit and default is 1000
          --page-offset int         Page offset, only used in combination with sort-by. Offset-based pagination has a result limit of 200K rows and does not guarantee unique results across pages
          --page-size int32         Page size, only used in combination with sort-by. The amount of rows to return. Use in combination with the offset or cursor parameter to get subsequent results. Default and max value of pagesize=1000 (default 1000)
          --parent-folder           Indicates that the given argument is path of the parent folder. All children are selected for list, not the folder itself. This flag needs no value, adding it sets the value to true.
          --project-id string       project ID to set current project context
          --sort-by string          specifies the order to list items
          --status stringArray      Add the status of the data. Available values : PARTIAL, AVAILABLE, ARCHIVING, ARCHIVED, UNARCHIVING, DELETING. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    icav2 projectdata list --project-id <project_id> --parent-folder /SOURCE/
    icav2 projectdata list --project-id <project_id> --parent-folder /SOURCE/ --data-type FOLDER
    This command mounts the project data as a file system directory for a given project
    
    Usage:
      icav2 projectdata mount [mount directory path] [flags]
    
    Flags:
          --allow-other         Allow other users to access this project
      -h, --help                help for mount
          --list                List currently mounted projects
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command moves data between projects. Use data id or a combination of path and --source-project-id to identify the source data. By default, the root folder of your current project will be used as destination. If you want to specify a destination, use --destination-folder to specify the destination path or folder id.
    
    Usage:
      icav2 projectdata move [data id] or [path] [flags]
    
    Flags:
          --background                  starts job in background on server. Does not provide upload progress updates. Use icav2 jobs get with the current job.id value
          --destination-folder string   folder id or path to where you want to move the data, default root of project
      -h, --help                        help for move
          --polling-interval int        polling interval in seconds for job status, values lower than 30 will be set to 30 (default 30)
          --project-id string           project ID to set current project context
          --source-project-id string    project ID from where the data needs to be moved, mandatory when using source path notation
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command fetches  temporal AWS and Rclone credentials for a given project-data. If path is given, project id from the flag --project-id is used. If flag not present project is taken from the context
    
    Usage:
      icav2 projectdata temporarycredentials [path or data Id] [flags]
    
    Flags:
      -h, --help                help for temporarycredentials
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command unarchives data for a given project
    
    Usage:
      icav2 projectdata unarchive [path or dataId] [flags]
    
    Flags:
      -h, --help                help for unarchive
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This unlinks data from a project. Use path or id to identifiy the data.
    
    Usage:
      icav2 projectdata unlink [data id] or [path] [flags]
    
    Flags:
      -h, --help                help for unlink
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command unmounts previously mounted project data
    
    Usage:
      icav2 projectdata unmount [flags]
    
    Flags:
          --directory-path string   Set path to unmount
      -h, --help                    help for unmount
          --project-id string       project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command updates some details of a data. Only user/tech tags, format and dates of will be archived/delete can be updated.
    
    Usage:
      icav2 projectdata update [data id] or [path] [flags]
    
    Flags:
          --add-tech-tag stringArray      Tech tag to add. Add flag multiple times for multiple values.
          --add-user-tag stringArray      User tag to add. Add flag multiple times for multiple values.
          --format-code string            Format to assign to the data. Only available for files.
      -h, --help                          help for update
          --project-id string             project ID to set current project context
          --remove-tech-tag stringArray   Tech tag to remove. Add flag multiple times for multiple values.
          --remove-user-tag stringArray   User tag to remove. Add flag multiple times for multiple values.
          --will-be-archived-at string    Time when data will be archived. Format is YYYY-MM-DD. Time is set to 00:00:00UTC time. Only available for files.
          --will-be-deleted-at string     Time when data will be deleted. Format is YYYY-MM-DD. Time is set to 00:00:00UTC time. Only available for files.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    Upload a file/folder.  For files : if the target path does not already exist, it will be created automatically. For folders : overwrite will need to be acknowledged. Argument "icapath" is optional.
    
    Usage:
      icav2 projectdata upload [local path] [icapath] [flags]
    
    Flags:
          --existing-sample                    Link to existing sample
      -h, --help                               help for upload
          --new-sample                         Create and link to new sample
          --num-workers int                    number of workers to parallelize.  Default calculated based on CPUs available.
          --project-id string                  project ID to set current project context
          --sample-description string          Set Sample Description for new sample
          --sample-id string                   Set Sample id of existing sample
          --sample-name string                 Set Sample name for new sample or from existing sample
          --sample-technical-tag stringArray   Set Sample Technical tag for new sample
          --sample-user-tag stringArray        Set Sample User tag for new sample
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    find $source -name '*.fastq.gz' | xargs -n 1 -P 10 -I {} icav2 projectdata upload {} /$target/
    while IFS=, read -r current_bam_file_name bam_path new_bam_file_name
    do
    screen -d -m icav2 projectdata upload ${bam_path}/${current_bam_file} /bam_files/${new_bam_file_name} --project-id $projectID
    done <./bam_files.csv 2>./log.txt
    This is the root command for actions that act on projects pipeline
    
    Usage:
      icav2 projectpipelines [command]
    
    Available Commands:
      create      Create a pipeline
      input       Retrieve input parameters of pipeline
      link        Link pipeline to a project
      list        List of pipelines for a project 
      start       Start a pipeline
      unlink      Unlink pipeline from a project
    
    Flags:
      -h, --help   help for projectpipelines
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projectpipelines [command] --help" for more information about a command.
    This command creates a  pipeline in the current project
    
    Usage:
      icav2 projectpipelines create [command]
    
    Available Commands:
      cwl          Create a cwl pipeline
      cwljson      Create a cwl Json pipeline
      nextflow     Create a nextflow pipeline
      nextflowjson Create a nextflow Json pipeline
    
    Flags:
      -h, --help                help for create
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projectpipelines create [command] --help" for more information about a command.
    This command creates a CWL pipeline in the current project using the argument as code for the pipeline
    
    Usage:
      icav2 projectpipelines create cwl [code] [flags]
    
    Flags:
          --category stringArray   Category of the cwl pipeline. Add flag multiple times for multiple values.
          --comment string         Version comments
          --description string     (*) Description of pipeline
      -h, --help                   help for cwl
          --html-doc string        Html documentation for the cwl pipeline
          --links string           links in json format
          --parameter string       (*) Path to the parameter XML file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --project-id string      project ID to set current project context
          --proprietary            Add the flag if this pipeline is proprietary
          --storage-size string    (*) Name of the storage size. Can be fetched using the command 'icav2 analysisstorages list'.
          --tool stringArray       Path to the tool cwl file. Add flag multiple times for multiple values. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --workflow string        (*) Path to the workflow cwl file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command creates a CWL Json pipeline in the current project using the argument as code for the pipeline
    
    Usage:
      icav2 projectpipelines create cwljson [code] [flags]
    
    Flags:
          --category stringArray         Category of the cwl pipeline. Add flag multiple times for multiple values.
          --comment string               Version comments
          --description string           (*) Description of pipeline
      -h, --help                         help for cwljson
          --html-doc string              Html documentation for the cwl pipeline
          --inputForm string             (*) Path to the input form file.
          --links string                 links in json format
          --onRender string              Path to the on render file.
          --onSubmit string              Path to the on submit file.
          --otherInputForm stringArray   Path to the other input form files. Add flag multiple times for multiple values. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --project-id string            project ID to set current project context
          --proprietary                  Add the flag if this pipeline is proprietary
          --storage-size string          (*) Name of the storage size. Can be fetched using the command 'icav2 analysisstorages list'.
          --tool stringArray             Path to the tool cwl file. Add flag multiple times for multiple values. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --workflow string              (*) Path to the workflow cwl file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command creates a Nextflow pipeline in the current project
    
    Usage:
      icav2 projectpipelines create nextflow [code] [flags]
    
    Flags:
          --category stringArray      Category of the nextflow pipeline. Add flag multiple times for multiple values.
          --comment string            Version comments
          --config string             Path to the config nextflow file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --description string        (*) Description of pipeline
      -h, --help                      help for nextflow
          --html-doc string           Html documentation fo the nexflow pipeline
          --links string              links in json format
          --main string               (*) Path to the main nextflow file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --nextflow-version string   Version of nextflow language to use.
          --other stringArray         Path to the other nextflow file. Add flag multiple times for multiple values. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --parameter string          (*) Path to the parameter XML file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --project-id string         project ID to set current project context
          --proprietary               Add the flag if this pipeline is proprietary
          --storage-size string       (*) Name of the storage size. Can be fetched using the command 'icav2 analysisstorages list'.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command creates a Nextflow Json pipeline in the current project
    
    Usage:
      icav2 projectpipelines create nextflowjson [code] [flags]
    
    Flags:
          --category stringArray         Category of the nextflow pipeline. Add flag multiple times for multiple values.
          --comment string               Version comments
          --config string                Path to the config nextflow file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --description string           (*) Description of pipeline
      -h, --help                         help for nextflowjson
          --html-doc string              Html documentation fo the nexflow pipeline
          --inputForm string             (*) Path to the input form file.
          --links string                 links in json format
          --main string                  (*) Path to the main nextflow file. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --nextflow-version string      Version of nextflow language to use.
          --onRender string              Path to the on render file.
          --onSubmit string              Path to the on submit file.
          --other stringArray            Path to the other nextflow file. Add flag multiple times for multiple values. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --otherInputForm stringArray   Path to the other input form files. Add flag multiple times for multiple values. You can set a custom file name and path by adding ':filename=' and the filename with optionally the path the file should be located in.
          --project-id string            project ID to set current project context
          --proprietary                  Add the flag if this pipeline is proprietary
          --storage-size string          (*) Name of the storage size. Can be fetched using the command 'icav2 analysisstorages list'.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    Retrieve input parameters of pipeline
    
    Usage:
      icav2 projectpipelines input [pipelineId] [flags]
    
    Flags:
      -h, --help                help for input
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This links a pipeline to a project. Use code or id to identifiy the pipeline. If code is not found, argument is used as id.
    
    Usage:
      icav2 projectpipelines link [pipeline code] or [pipeline id] [flags]
    
    Flags:
      -h, --help                       help for link
          --project-id string          project ID to set current project context
          --source-project-id string   project ID from where the pipeline needs to be linked, mandatory when using pipeline code
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command lists the pipelines for a given project
    
    Usage:
      icav2 projectpipelines list [flags]
    
    Flags:
      -h, --help                help for list
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command starts a  pipeline in the current project
    
    Usage:
      icav2 projectpipelines start [command]
    
    Available Commands:
      cwl          Start a CWL pipeline
      cwljson      Start a CWL Json pipeline
      nextflow     Start a Nextflow pipeline
      nextflowjson Start a Nextflow Json pipeline
    
    Flags:
      -h, --help                help for start
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projectpipelines start [command] --help" for more information about a command.
    This command starts a CWL pipeline for a given pipeline id, or for a pipeline code from the current project.
    
    Usage:
      icav2 projectpipelines start cwl [pipeline id] or [code] [flags]
    
    Flags:
          --data-id stringArray           Enter data id's as follows : dataId{optional-mount-path} . Add flag multiple times for multiple values.  Mount path is optional and can be absolute and relative and can not contain curly braces.
          --data-parameters stringArray   Enter data-parameters as follows : parameterCode:referenceDataId . Add flag multiple times for multiple values.
      -h, --help                          help for cwl
          --idempotency-key string        Add a maximum 255 character idempotency key to prevent duplicate requests. The  response is retained for 7 days so the key must be unique during that timeframe.
          --input stringArray             Enter inputs as follows : parametercode:dataId,dataId{optional-mount-path},dataId,... . Add flag multiple times for multiple values. Mount path is optional and can be absolute and relative and can not contain curly braces and commas.
          --input-json string             Analysis input JSON string. JSON input works only with file-based CWL pipelines (built using code, not a graphical editor in ICA).
          --output-parent-folder string   The id of the folder in which the output folder should be created.
          --parameters stringArray        Enter single-value parameters as code:value. Enter multi-value parameters as code:"'value1','value2','value3'". To add multiple values, add the flag multiple times.
          --project-id string             project ID to set current project context
          --reference-tag stringArray     Reference tag. Add flag multiple times for multiple values.
          --storage-size string           (*) Name of the storage size. Can be fetched using the command 'icav2 analysisstorages list'
          --technical-tag stringArray     Technical tag. Add flag multiple times for multiple values.
          --type-input string             (*) Input type STRUCTURED or JSON
          --user-reference string         (*) User reference
          --user-tag stringArray          User tag. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command starts a CWL Json pipeline for a given pipeline id, or for a pipeline code from the current project. See ICA CLI documentation for more information (https://help.ica.illumina.com/).
    
    Usage:
      icav2 projectpipelines start cwljson [pipeline id] or [code] [flags]
    
    Flags:
          --field stringArray             Fields. Add flag multiple times for multiple fields. --field fieldA:value --field multivalueFieldB:value1,value2
          --field-data stringArray        Data fields. Add flag multiple times for multiple fields. --field-data fieldA:fil.id --field-data multivalueFieldB:fil.id1,fil.id2
          --group stringArray             Groups. Add flag multiple times for multiple fields in the group. --group groupA.index1.multivalueFieldA:value1,value2 --group groupA.index1.fieldB:value --group groupB.index1.fieldA:value --group groupB.index2.fieldA:value
          --group-data stringArray        Data groups. Add flag multiple times for multiple fields in the group. --group-data groupA.index1.multivalueFieldA:fil.id1,fil.id2 --group-data groupA.index1.fieldB:fil.id --group-data groupB.index1.fieldA:fil.id --group-data groupB.index2.fieldA:fil.id
      -h, --help                          help for cwljson
          --idempotency-key string        Add a maximum 255 character idempotency key to prevent duplicate requests. The  response is retained for 7 days so the key must be unique during that timeframe.
          --output-parent-folder string   The id of the folder in which the output folder should be created.
          --project-id string             project ID to set current project context
          --reference-tag stringArray     Reference tag. Add flag multiple times for multiple values.
          --storage-size string           (*) Name of the storage size. Can be fetched using the command 'icav2  list'.
          --technical-tag stringArray     Technical tag. Add flag multiple times for multiple values.
          --user-reference string         (*) User reference
          --user-tag stringArray          User tag. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    --field fieldA:valueA --fieldB multivalueFieldB:valueB1,valueB2 --field-data DataFieldC:file.id"
        "fields": [
          {
            "id": "fieldA",
            "values": [
              "valueA"
            ]
          },
          {
            "id": "multivalueFieldB",
            "values": [
              "valueB1",
              "valueB2"
            ]
          },
          {
            "id": "DataFieldC",
            "values": [
              "file.id"
            ]
          }
        ]
    --field asection:SECTION1
    --field atext:"this is atext text"
    --field ttt:tb1
    --field notallowedrole:f
    --field notallowedcondition:"this is a not allowed text box"
    --field maxagesum:20
    --field-data txts1:fil.ade9bd0b6113431a2de108d9fe48a3d8
    --field-data txts2:fil.ade9bd0b6113431a2de108d9fe48a3d7{/dir1/dir2},fil.ade9bd0b6113431a2de108d9fe48a3d6{/dir3/dir4}
        "fields": [
        {
          "id": "asection",
          "values": [
            "SECTION1"
          ]
        },
        {
          "id": "atext",
          "values": [
            "this is atext text"
          ]
        },
        {
          "id": "ttt",
          "values": [
            "tb1"
          ]
        },
        {
          "id": "notallowedrole",
          "values": [
            "f"
          ]
        },
        {
          "id": "notallowedcondition",
          "values": [
            "this is a not allowed text box"
          ]
        },
        {
          "id": "maxagesum",
          "values": [
            "20"
          ]
        },
        {
          "dataValues": [
            {
              "dataId": "fil.ade9bd0b6113431a2de108d9fe48a3d8"
            }
          ],
          "id": "txts1"
        },
        {
          "dataValues": [
            {
              "dataId": "fil.ade9bd0b6113431a2de108d9fe48a3d7",
              "mountPath": "/dir1/dir2"
            },
            {
              "dataId": "fil.ade9bd0b6113431a2de108d9fe48a3d6",
              "mountPath": "/dir3/dir4"
            }
          ],
          "id": "txts2"
        }
      ],
    --group group1.0.age:80
    --group group1.0.role:f
    --group group1.0.conditions:cancer,covid
    --group-data group1.0.info:fil.a4f17ecf13ca4f692fd008d9fe48a3d7
    
    --group group1.1.age:20
    --group group1.1.role:m
    --group-data group1.1.info:fil.a4f17ecf13ca4f692fd008d9fe48a3d7
    
    --group group2.0.roleForGroup2:f
    "groups": [
        {
          "id": "group1",
          "values": [
            {
              "values": [
                {
                  "id": "age",
                  "values": [
                    "80"
                  ]
                },
                {
                  "id": "role",
                  "values": [
                    "f"
                  ]
                },
                {
                  "id": "conditions",
                  "values": [
                    "cancer",
                    "covid"
                  ]
                },
                {
                  "dataValues": [
                    {
                      "dataId": "fil.a4f17ecf13ca4f692fd008d9fe48a3d7"
                    }
                  ],
                  "id": "info"
                }
              ]
            },
            {
              "values": [
                {
                  "id": "age",
                  "values": [
                    "20"
                  ]
                },
                {
                  "id": "role",
                  "values": [
                    "m"
                  ]
                },
                {
                  "dataValues": [
                    {
                      "dataId": "fil.a4f17ecf13ca4f692fd008d9fe48a3d7"
                    }
                  ],
                  "id": "info"
                }
              ]
            }
          ]
        },
        {
          "id": "group2",
          "values": [
            {
              "values": [
                {
                  "id": "roleForGroup2",
                  "values": [
                    "f"
                  ]
                }
              ]
            }
          ]
        }
      ]
    This command starts a Nextflow pipeline for a given pipeline id, or for a pipeline code from the current project.
    
    Usage:
      icav2 projectpipelines start nextflow [pipeline id] or [code] [flags]
    
    Flags:
          --data-parameters stringArray   Enter data-parameters as follows : parameterCode:referenceDataId . Add flag multiple times for multiple values.
      -h, --help                          help for nextflow
          --idempotency-key string        Add a maximum 255 character idempotency key to prevent duplicate requests. The  response is retained for 7 days so the key must be unique during that timeframe.
          --input stringArray             Enter inputs as follows : parametercode:dataId,dataId{optional-mount-path},dataId,... . Add flag multiple times for multiple values. Mount path is optional and can be absolute and relative and can not contain curly braces and commas.
          --output-parent-folder string   The id of the folder in which the output folder should be created.
          --parameters stringArray        Enter single-value parameters as code:value. Enter multi-value parameters as code:"'value1','value2','value3'". To add multiple values, add the flag multiple times.
          --project-id string             project ID to set current project context
          --reference-tag stringArray     Reference tag. Add flag multiple times for multiple values.
          --storage-size string           (*) Name of the storage size. Can be fetched using the command 'icav2  list'.
          --technical-tag stringArray     Technical tag. Add flag multiple times for multiple values.
          --user-reference string         (*) User reference
          --user-tag stringArray          User tag. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command starts a Nextflow Json pipeline for a given pipeline id, or for a pipeline code from the current project.  See ICA CLI documentation for more information (https://help.ica.illumina.com/).
    
    Usage:
      icav2 projectpipelines start nextflowjson [pipeline id] or [code] [flags]
    
    Flags:
          --field stringArray             Fields. Add flag multiple times for multiple fields. --field fieldA:value --field multivalueFieldB:value1,value2
          --field-data stringArray        Data fields. Add flag multiple times for multiple fields. --field-data fieldA:fil.id --field-data multivalueFieldB:fil.id1,fil.id2
          --group stringArray             Groups. Add flag multiple times for multiple fields in the group. --group groupA.index1.multivalueFieldA:value1,value2 --group groupA.index1.fieldB:value --group groupB.index1.fieldA:value --group groupB.index2.fieldA:value
          --group-data stringArray        Data groups. Add flag multiple times for multiple fields in the group. --group-data groupA.index1.multivalueFieldA:fil.id1,fil.id2 --group-data groupA.index1.fieldB:fil.id --group-data groupB.index1.fieldA:fil.id --group-data groupB.index2.fieldA:fil.id
      -h, --help                          help for nextflowjson
          --idempotency-key string        Add a maximum 255 character idempotency key to prevent duplicate requests. The  response is retained for 7 days so the key must be unique during that timeframe.
          --output-parent-folder string   The id of the folder in which the output folder should be created.
          --project-id string             project ID to set current project context
          --reference-tag stringArray     Reference tag. Add flag multiple times for multiple values.
          --storage-size string           (*) Name of the storage size. Can be fetched using the command 'icav2  list'.
          --technical-tag stringArray     Technical tag. Add flag multiple times for multiple values.
          --user-reference string         (*) User reference
          --user-tag stringArray          User tag. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    --field fieldA:valueA --fieldB multivalueFieldB:valueB1,valueB2 --field-data DataFieldC:file.id"
        "fields": [
          {
            "id": "fieldA",
            "values": [
              "valueA"
            ]
          },
          {
            "id": "multivalueFieldB",
            "values": [
              "valueB1",
              "valueB2"
            ]
          },
          {
            "id": "DataFieldC",
            "values": [
              "file.id"
            ]
          }
        ]
    --field asection:SECTION1
    --field atext:"this is atext text"
    --field ttt:tb1
    --field notallowedrole:f
    --field notallowedcondition:"this is a not allowed text box"
    --field maxagesum:20
    --field-data txts1:fil.ade9bd0b6113431a2de108d9fe48a3d8
    --field-data txts2:fil.ade9bd0b6113431a2de108d9fe48a3d7{/dir1/dir2},fil.ade9bd0b6113431a2de108d9fe48a3d6{/dir3/dir4}
        "fields": [
        {
          "id": "asection",
          "values": [
            "SECTION1"
          ]
        },
        {
          "id": "atext",
          "values": [
            "this is atext text"
          ]
        },
        {
          "id": "ttt",
          "values": [
            "tb1"
          ]
        },
        {
          "id": "notallowedrole",
          "values": [
            "f"
          ]
        },
        {
          "id": "notallowedcondition",
          "values": [
            "this is a not allowed text box"
          ]
        },
        {
          "id": "maxagesum",
          "values": [
            "20"
          ]
        },
        {
          "dataValues": [
            {
              "dataId": "fil.ade9bd0b6113431a2de108d9fe48a3d8"
            }
          ],
          "id": "txts1"
        },
        {
          "dataValues": [
            {
              "dataId": "fil.ade9bd0b6113431a2de108d9fe48a3d7",
              "mountPath": "/dir1/dir2"
            },
            {
              "dataId": "fil.ade9bd0b6113431a2de108d9fe48a3d6",
              "mountPath": "/dir3/dir4"
            }
          ],
          "id": "txts2"
        }
      ],
    --group group1.0.age:80
    --group group1.0.role:f
    --group group1.0.conditions:cancer,covid
    --group-data group1.0.info:fil.a4f17ecf13ca4f692fd008d9fe48a3d7
    
    --group group1.1.age:20
    --group group1.1.role:m
    --group-data group1.1.info:fil.a4f17ecf13ca4f692fd008d9fe48a3d7
    
    --group group2.0.roleForGroup2:f
    "groups": [
        {
          "id": "group1",
          "values": [
            {
              "values": [
                {
                  "id": "age",
                  "values": [
                    "80"
                  ]
                },
                {
                  "id": "role",
                  "values": [
                    "f"
                  ]
                },
                {
                  "id": "conditions",
                  "values": [
                    "cancer",
                    "covid"
                  ]
                },
                {
                  "dataValues": [
                    {
                      "dataId": "fil.a4f17ecf13ca4f692fd008d9fe48a3d7"
                    }
                  ],
                  "id": "info"
                }
              ]
            },
            {
              "values": [
                {
                  "id": "age",
                  "values": [
                    "20"
                  ]
                },
                {
                  "id": "role",
                  "values": [
                    "m"
                  ]
                },
                {
                  "dataValues": [
                    {
                      "dataId": "fil.a4f17ecf13ca4f692fd008d9fe48a3d7"
                    }
                  ],
                  "id": "info"
                }
              ]
            }
          ]
        },
        {
          "id": "group2",
          "values": [
            {
              "values": [
                {
                  "id": "roleForGroup2",
                  "values": [
                    "f"
                  ]
                }
              ]
            }
          ]
        }
      ]
    This unlinks a pipeline from a project. Use code or id to identifiy the pipeline. If code is not found, argument is used as id.
    
    Usage:
      icav2 projectpipelines unlink [pipeline code] or [pipeline id] [flags]
    
    Flags:
      -h, --help                help for unlink
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This is the root command for actions that act on projects
    
    Usage:
      icav2 projects [command]
    
    Available Commands:
      create      Create a project
      enter       Enter project context
      exit        Exit project context
      get         Get details of a project
      list        List projects
    
    Flags:
      -h, --help   help for projects
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projects [command] --help" for more information about a command.
    This command creates a project.
    
    Usage:
      icav2 projects create [projectname] [flags]
    
    Flags:
          --billing-mode string                Billing mode , defaults to PROJECT (default "PROJECT")
          --data-sharing                       Indicates whether the data and samples created in this project can be linked to other Projects. This flag needs no value, adding it sets the value to true.
      -h, --help                               help for create
          --info string                        Info about the project
          --metadata-model string              Id of the metadata model. 
          --owner string                       Owner of the project. Default is the current user
          --region string                      Region of the project. When not specified : takes a default when there is only 1 region, else a choice will be given.
          --short-descr string                 Short pipelineDescription of the project
          --storage-bundle string              Id of the storage bundle. When not specified : takes a default when there is only 1 bundle, else a choice will be given. 
          --storage-config string              An optional storage configuration id to have self managed storage.
          --storage-config-sub-folder string   Required when specifying a storageConfigurationId. The subfolder determines the object prefix of your self managed storage.
          --technical-tag stringArray          Technical tags for this project. Add flag multiple times for multiple values.
          --user-tag stringArray               User tags for this project. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command sets the project context for future commands
    
    Usage:
      icav2 projects enter [projectname] or [project id] [flags]
    
    Flags:
      -h, --help   help for enter
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command switches the user back to their personal context
    
    Usage:
      icav2 projects exit [flags]
    
    Flags:
      -h, --help                help for exit
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command fetches the details of the current project. If no project id is given, we take the one from the config file.
    
    Usage:
      icav2 projects get [project id] [flags]
    
    Flags:
      -h, --help   help for get
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command lists the projects for the current user. Page-offset can only be used in combination with sort-by. Sorting can be done on 
    - name
    - shortDescription
    - information
    
    Usage:
      icav2 projects list [flags]
    
    Flags:
      -h, --help              help for list
          --max-items int     maximum number of items to return, the limit and default is 1000
          --page-offset int   Page offset, only used in combination with sort-by. Offset-based pagination has a result limit of 200K rows and does not guarantee unique results across pages
          --page-size int32   Page size, only used in combination with sort-by. The amount of rows to return. Use in combination with the offset or cursor parameter to get subsequent results. Default and max value of pagesize=1000 (default 1000)
          --sort-by string    specifies the order to list items
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This is the root command for actions that act on projects samples
    
    Usage:
      icav2 projectsamples [command]
    
    Available Commands:
      complete    Set sample to complete
      create      Create a sample for a project
      delete      Delete a sample for a project
      get         Get details of a sample
      link        Link data to a sample for a project
      list        List of samples for a project 
      listdata    List data from given sample
      unlink      Unlink data from a sample for a project
      update      Update a sample for a project
    
    Flags:
      -h, --help   help for projectsamples
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 projectsamples [command] --help" for more information about a command.
    The sample status will be set to 'Available' and a sample completed event will be triggered as well.
    
    Usage:
      icav2 projectsamples complete [sampleId] [flags]
    
    Flags:
      -h, --help                help for complete
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command creates a sample for a project. It takes the name of the sample as argument.
    
    Usage:
      icav2 projectsamples create [name] [flags]
    
    Flags:
          --description string          Description 
      -h, --help                        help for create
          --project-id string           project ID to set current project context
          --technical-tag stringArray   Technical tag. Add flag multiple times for multiple values.
          --user-tag stringArray        User tag. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command deletes a sample from a project. The different flags indicate the way they are deleted. Only 1 flag can be used.
    
    Usage:
      icav2 projectsamples delete [sampleId] [flags]
    
    Flags:
          --deep         Delete the entire sample: sample and linked files will be deleted from your project.
      -h, --help         help for delete
          --mark         Mark a sample as deleted.
          --unlink       Unlinking the sample: sample is deleted and files are unlinked and available again for linking to another sample.
          --with-input   Delete the sample as well as its input data: sample is deleted from your project, the input files and pipeline output folders are still present in the project but will not be available for linking to a new sample.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command fetches the details a sample using the argument as a name, if nothing found, the argument is used as an id (uuid).
    
    Usage:
      icav2 projectsamples get [sample id] or [name] [flags]
    
    Flags:
      -h, --help                help for get
          --project-id string   project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command adds data to a project sample. Argument is the id of the project sample
    
    Usage:
      icav2 projectsamples link [sampleId] [flags]
    
    Flags:
          --data-id stringArray   (*) Data id of the data that needs to be linked to the project sample. Add flag multiple times for multiple values.
      -h, --help                  help for link
          --project-id string     project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command lists the samples for a given project
    
    Usage:
      icav2 projectsamples list [flags]
    
    Flags:
      -h, --help                        help for list
          --include-deleted             Include the deleted samples in the list. Default set to false.
          --project-id string           project ID to set current project context
          --technical-tag stringArray   Technical tags to filter on. Add flag multiple times for multiple values.
          --user-tag stringArray        User tags to filter on. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command lists the data for a given sample. It only supports offset based, and default sorting is done on timeCreated. Sorting can be done on timeCreated
    - timeModified
    - name
    - path
    - fileSizeInBytes
    - status
    - format
    - dataType
    - willBeArchivedAt
    - willBeDeletedAt
    
    Usage:
      icav2 projectsamples listdata [sampleId] [path] [flags]
    
    Flags:
          --data-type string        Data type. Available values : FILE or FOLDER
          --file-name stringArray   The filenames to filter on. The filenameMatchMode-parameter determines how the filtering is done. Add flag multiple times for multiple values.
      -h, --help                    help for listdata
          --match-mode string       Match mode for the file name. Available values : EXACT (default), EXCLUDE, FUZZY.
          --max-items int           maximum number of items to return, the limit and default is 1000
          --page-offset int         Page offset, only used in combination with sort-by. Offset-based pagination has a result limit of 200K rows and does not guarantee unique results across pages
          --page-size int32         Page size, only used in combination with sort-by. The amount of rows to return. Use in combination with the offset or cursor parameter to get subsequent results. Default and max value of pagesize=1000 (default 1000)
          --parent-folder           Indicates that the given argument is path of the parent folder. All children are selected for list, not the folder itself. This flag needs no value, adding it sets the value to true.
          --project-id string       project ID to set current project context
          --sort-by string          specifies the order to list items (default "timeCreated Desc")
          --status stringArray      Add the status of the data. Available values : PARTIAL, AVAILABLE, ARCHIVING, ARCHIVED, UNARCHIVING, DELETING. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command removes data from a project sample. Argument is the id of the project sample
    
    Usage:
      icav2 projectsamples unlink [sampleId] [flags]
    
    Flags:
          --data-id stringArray   (*) Data id of the data that will be removed from the project sample. Add flag multiple times for multiple values.
      -h, --help                  help for unlink
          --project-id string     project ID to set current project context
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command updates a sample for a project. Name,description, user and technical tags can be updated
    
    Usage:
      icav2 projectsamples update [sampleId] [flags]
    
    Flags:
          --add-tech-tag stringArray      Tech tag to add. Add flag multiple times for multiple values.
          --add-user-tag stringArray      User tag to add. Add flag multiple times for multiple values.
      -h, --help                          help for update
          --name string                   Name 
          --project-id string             project ID to set current project context
          --remove-tech-tag stringArray   Tech tag to remove. Add flag multiple times for multiple values.
          --remove-user-tag stringArray   User tag to remove. Add flag multiple times for multiple values.
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This is the root command for actions that act on regions
    
    Usage:
      icav2 regions [command]
    
    Available Commands:
      list        list of regions
    
    Flags:
      -h, --help   help for regions
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 regions [command] --help" for more information about a command.
    This command lists all the regions
    
    Usage:
      icav2 regions list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This is the root command for actions that act on storage bundles
    
    Usage:
      icav2 storagebundles [command]
    
    Available Commands:
      list        list of storage bundles
    
    Flags:
      -h, --help   help for storagebundles
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 storagebundles [command] --help" for more information about a command.
    This command lists all the storage bundles id's
    
    Usage:
      icav2 storagebundles list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This is the root command for actions that act on storage configurations
    
    Usage:
      icav2 storageconfigurations [command]
    
    Available Commands:
      list        list of storage configurations
    
    Flags:
      -h, --help   help for storageconfigurations
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 storageconfigurations [command] --help" for more information about a command.
    This command lists all the storage configurations
    
    Usage:
      icav2 storageconfigurations list [flags]
    
    Flags:
      -h, --help   help for list
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This is the root command for actions that act on tokens
    
    Usage:
      icav2 tokens [command]
    
    Available Commands:
      create      Create a JWT token
      refresh     Refresh a JWT token from basic authentication
    
    Flags:
      -h, --help   help for tokens
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    
    Use "icav2 tokens [command] --help" for more information about a command.
    This command creates a JWT token from the API key.
    
    Usage:
      icav2 tokens create [flags]
    
    Flags:
      -h, --help   help for create
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    This command refreshes a JWT token from basic authentication with gantype JWT-bearer that is set with the -t flag.
    
    Usage:
      icav2 tokens refresh [flags]
    
    Flags:
      -h, --help   help for refresh
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service
    The version of this application
    
    Usage:
      icav2 version [flags]
    
    Flags:
      -h, --help   help for version
    
    Global Flags:
      -t, --access-token string    JWT used to call rest service
      -o, --output-format string   output format (default "table")
      -s, --server-url string      server url to direct commands
      -k, --x-api-key string       api key used to call rest service